Which of the following statements about the processes of the central dogma is/are incorrect?I. Replication occurs only once during the life cycle of a cell.II. The entire sequence of a DNA molecule carries instructions for the synthesis of proteins and nucleic acids.III. The products of transcription all eventually undergo translation.IV. Transcription and replication both involve the use of RNA molecules.V. The translation of the genetic code is directly based on the sequence of the template DNA strand.O , I, and VO II, II, and VO l and IVO II, II, and IVO Only l is incorrect

Answered: Image /qna-images/answer/d6d16222-ceac-4790-b1be-a06a68d6fe6b.jpg

Which of the following statements about the processes of the central dogma is/are incorrect? I. Replication occurs only once during the life cycle of a cell. II. The entire sequence of a DNA molecule carries instructions for the synthesis of proteins and nucleic acids. II. The products of transcription all eventually undergo translation. IV. Transcription and replication both involve the use of RNA molecules. V. The translation of the genetic code is directly based on the sequence of the template DNA strand.

Which of the following statements about the processes of the central dogma is/are incorrect? I. Replication occurs only once during the life cycle of a cell. II. The entire sequence of a DNA molecule carries instructions for the synthesis of proteins and nucleic acids. II. The products of transcription all eventually undergo translation. IV. Transcription and replication both involve the use of RNA molecules. V. The translation of the genetic code is directly based on the sequence of the template DNA strand.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 23QP: How does DNA replication occur in a precise manner to ensure that identical genetic information is...

See similar textbooks

Similar questions

Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:
Why is DNA replication is considered a semi-discontinuous process? Explain in detail.
Each of the following statements about protein synthesis is false.Correct each to make a true statement. a. In a gene, each nucleotide specifies one amino acid in a protein sequence. b. A transcription factor must bind to the promoter region of a gene before the enzyme DNA synthetase is able to bind and begin transcription. c. The enzyme RNA polymerase builds a strand of transfer RNA, whose codons are complementary to DNA’s triplets. d. Proteins destined for secretion from the cell enter the nucleus after translation, to be folded and modified. e. During translation, amino acids are delivered by the messenger RNA transcrip
Which of the following statements are TRUE?I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand.II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′-triphosphate.IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotide
Which of the following statements are TRUE?I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand.II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′-triphosphate.IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotide a. I only b. II only c. I and IV d. III and IV
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
Within the Central Dogma, what is the primary function of DNA? a. make proteins b. preserve nuclear integrity c. maintain the genetic information d. keep a boundary between RNA and Protein
Following transcription, the RNA has a complementary sequence of which of the following?Question 9 options: A) regulatory sequences B) termination sequences in the coding strand of DNA C) the template strand of DNA D) none of the answers are correct
What are the majors steps in replication, transcription, and translation? What are the important enzymes and processes that is involved in those steps?
The commonly prescribed antibiotic Clindamycin blocks the peptide bond formation between amino acids during protein synthesis. This would happen during A) transformation. B) translation. C) transcription. D) replication. E) mitosis.
1. Explain the concept of central dogma of biology 2. Explain the definition of DNA replication and list general steps of Replication 3. Explain the definition of Transcription and list general steps of Transcription
If a cell were damaged, & DNA ligase could no longer be produced, how would replication be affected?