Which of the followings best describes the histone mRNA structure? histone mRNAs end in a terminal stem-loop and does not have 5’cap histone mRNAs begin with a cap (m G), and almost all end with a poly(A) tail histone mRNAs begin with a cap (m G), and end in a terminal stem-loop

Which of the followings best describes the histone mRNA structure? histone mRNAs end in a terminal stem-loop and does not have 5’cap histone mRNAs begin with a cap (m G), and almost all end with a poly(A) tail histone mRNAs begin with a cap (m G), and end in a terminal stem-loop

Name: Which of the followings best describes the histone mRNA structure? his
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the followings best describes the histone mRNA structure? histone mRNAs end in a terminal stem-loop and does not have 5’caphistone mRNAs begin with a cap (m G), and almost all end with a poly(A) tailhistone mRNAs begin with a cap (m G), and

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 8TYU: Which of the following is/are typically removed from pre-mRNA during nuclear processing in...

See similar textbooks

Similar questions

Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH modifications, or NEITHER modification. Briefly (1 sentence) support your answer. Promotes translation of the mRNA at the 3' end. Acts to prevent degradation of the mRNA by exonucleases. Promotes splicing of the mRNA. Promotes binding of transcription factors to the Mediator complex.
Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of its protein product? 5'-AUGUGUUGAUGUAUCAGACCUGUC ---
All of the following EXCEPT which one occurs between transcription and translation. -Introns are added to the RNA transcript -Exons are spliced together to form the final RNA transcript. -A modified adenine “cap” is added to the 5’ end of the RNA transcript. -All of these occur during RNA processing -A series of adenines, a “poly A tail” is added to the 3’ end of the RNA transcript.
As shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and six introns, which are numbered in green. A splicing repressor binds at the 3′ splice site at the end of intron 4, which is just before exon 5. What exons will be included in the mature mRNA?
An mRNA encodes a polypeptide that is 312 amino acids in length. The fifty-third codon in this polypeptide is a tryptophan codon. A mutation in the gene that encodes this polypeptide changes this tryptophan codon into a stop codon. How many amino acids occur in the resulting polypeptide: 52, 53, 259, or 260?
Which of the following is false? Options: tRNAs are heavily processed but in a manner that is different than mRNAs mRNAs are protected from degradation by modifications at the 5' and 3' end rRNAs are all cleaved from a larger pre-rRNA precursor Group II splicing requires protein and RNA to excise intron sequences methylation of histone 3 at K4 results is mostly associated with activated transcription
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
Transcription and translation are separate processes in gene expression; however, they have similarties. The following terms all relate to translation. Which of these has a role that is most similar to that of the transcription start sit during transcription ? A- Start Codon B- Stop Codon C- tRNA D- Amino Acid
An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon, what is the third amino acid of the translated polypeptide?
Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the stop codon, the untranslated regions and predict the amino acid sequence of the polypeptid