please answer 4-6 Fill in the blanks:is the term used to describe the genetic code because the rulesthat relate the nucleotide sequence in the MRNA to the amino acia is the same inmost organisms.is the term used to describe the genetic coce because codonsdo not overlap, and are not separated by spacesis the term used to describe the genetic coce because there ismore than one codon that specify for an amino aciais the term used to describe the genetic code because a codonspecify only for one amino acidis the term used to describe the DNA because one strand runs 5to 3 while the other strand runs 3 to 5is the term used to describe the DNA because adenine is alwayspaired with thymine while guanine is always paired with cytosineis the term that refers to the separation of the couble strancedDNAis a term that refers to the increase in the UV absorption of DNAat two hundred sixty nanometeris a term that refers to a DNA or RNA of known sequence that isused to detect the presence of the same DNA or RNA sequence in a sampleis the chemical name of the material added to the 5 end of anMRNA to protect it against nuclease aigestion

The genetic code is a set of rules that determine how the genetic information from four-letter codes…

Fill in the blanks: is the term used to describe the genetic coce because the rules that relate the nucleotide sequence in the MRNA to the amino acia is the same in most organisms. is the term usea to describe the genetic coce because codons do not overlap, and are not separated by spaces is the term used to describe the genetic coce because there is more tnan one codon that specify for an amino acia is the term used to describe the genetic coce because a codon specify only for one amino acia is the term used to describe the DNA Decause one strand runs 5' to 3 while tne otner strand runs 3' to 5' is the term usea to describe tne DNA because adenine is always paired witn thymine while guanine is always pairea with cytosine is the term thet refers to tne separation of the ouble stranded DNA is a term thet refers to tne increase in the UV absorption of DNA at two hunared sixty nanometer is a term that refers to a DNA or RNA of known sequence that is used to detect the presence of the same DNA or RNA sequence in a sample is the chemical neme of the material added to the 5' end of an MRNA to protect it against nuclease aigestion

Fill in the blanks: is the term used to describe the genetic coce because the rules that relate the nucleotide sequence in the MRNA to the amino acia is the same in most organisms. is the term usea to describe the genetic coce because codons do not overlap, and are not separated by spaces is the term used to describe the genetic coce because there is more tnan one codon that specify for an amino acia is the term used to describe the genetic coce because a codon specify only for one amino acia is the term used to describe the DNA Decause one strand runs 5' to 3 while tne otner strand runs 3' to 5' is the term usea to describe tne DNA because adenine is always paired witn thymine while guanine is always pairea with cytosine is the term thet refers to tne separation of the ouble stranded DNA is a term thet refers to tne increase in the UV absorption of DNA at two hunared sixty nanometer is a term that refers to a DNA or RNA of known sequence that is used to detect the presence of the same DNA or RNA sequence in a sample is the chemical neme of the material added to the 5' end of an MRNA to protect it against nuclease aigestion

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

Since it was deciphered four decades ago, somehave claimed that the genetic code must be a frozen acci-dent, while others have argued that it was shaped by nat-ural selection. A striking feature of the genetic code is itsinherent resistance to the effects of mutation. For example,a change in the third position of a codon often specifies thesame amino acid or one with similar chemical properties.The natural code resists mutation more effectively (is lesssusceptible to error) than most other possible versions, asillustrated in Figure Q1–1. Only one in a million comput-er-generated “random” codes is more error-resistant thanthe natural genetic code. Does the extraordinary mutationresistance of the genetic code argue in favor of its origin asa frozen accident or as a result of natural selection? Explainyour reasoning.
Transfer RNA is the molecule thata. contributes to the structure of ribosomesb. adapts the genetic code to protein structurec. transfers the DNA code to mRNAd. provides the master code for amino acids
Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop codon d. AUG codon
Which of the following is true about the three major classes of RNAs in the cell: mRNAs, tRNAs, and rRNAs? A. mRNAs encode polypeptide chains. B. tRNAs are structural components of the ribosome. C. rRNAs are adapter molecules that translate the information on an mRNA into a polypeptide sequence. D. mRNAs can also encode tRNAs and rRNAs.
The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this gene code for? The top is the coding strand. 5' GGCTATGTATAGGGTAAACTTCTGACGCCTA 3' 3’ CCGATACATATCCCATTTGAAGACTGCGGAT 5’
Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
CATCTACAAATAGCACCTAATTGTG What is the MRNA What is the protein What is the phenotype
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Which of the following is/are not found in a bacterial mRNA molecule? (a) stop codon (b) upstream leader sequences (c) downstream trailing sequences (d) start codon (e) promoter sequences
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. introns