Which one of the following amino acids is phosphorylated during the process of promoter clearance by eukaryotic RNA polymerase II? tyrosine threonine serine proline
Q: Amino acid sequence in a protein that can form N-glycosylation is called a glycosylation sequon.…
A: N-linked glycosylation is a post-translational modification process that occurs in the endoplasmic…
Q: Count Experiment Name: Specimen Name: Tube Name: Record Date: SOP GUID Display Range Population P1…
A: The flow cytometry data in the given image uses BV-605 as the fluorescent molecule. From the…
Q: When doing automated sequencing, on the other hand, all 4 dideoxynucleotides are added to the same…
A: The genetic information is encoded in the sequence of DNA that is the genetic material. The Sanger…
Q: The gels we will be using for electrophoresis during the next lab consist of 1% agarose. Suppose you…
A: There are different ways to denote the concentration of a solution. Per cent (w/v) means there is 1…
Q: referred to feedback inhibition as “Goldilocks regulation”. Describe how feedback inhibition keeps…
A: Biochemical pathways and reactions are occurring constantly in cells. These pathways convert the…
Q: Question 12 of 25 Which of the following are characteristics of animal cells? Select the correct…
A: The somatic cell in animals undergo division by the process of mitosis. The cellular microtubular…
Q: Calculate 1/[S] and 1/V to complete the table. Use this data to draw a Lineweaver-Burke plot, with…
A: A Lineweaver-Burk plot represents the relationship between the reciprocal values of substrate…
Q: Which of the following statements concerning enzymes is TRUE? a. Enzymes can increase the…
A: Enzymes are biological catalysts that enhance the rate of biochemical reactions. The enzymes are…
Q: The figure shows an example of a thermal denaturation plot. The melting temperature (Tm) is the…
A: The proteins re folded into their proper three dimensional structure and this folding is driven by…
Q: Metabolic pathway characteristics: a. Give one example of an amphibolic pathway. b. What…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: Which of the following is not true about a-amino acids? have at least 2 pka values O negatively…
A: The proteins are composed of twenty naturally occurring amino acids. The amino acids can be…
Q: In the degradation of glycogen, the purpose of the debranching enzyme is to remove the last four…
A: Glycogenolysis is the breakdown of glycogen into glucose by a set of enzymes. The key enzymes of the…
Q: Please write down the DNA sequence inferred from the below DNA gel. Shown are the products of a…
A: DNA is the genetic material in most living organisms. The information in a DNA molecule is encoded…
Q: Consider the given data for an enzyme-catalyzed reaction. Determine the Vm, Km and the type of…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Arginine has three ionizable groups. The pK of α-COOH is 2.18; α-NH 3 + , 9.09; and the R-group,…
A: Isoelectric point (pI) is the pH at which the net electric charge of the amino acid is zero. When,…
Q: Sketch on one reaction rate vs. substrate concentration graph & sketch on one Lineweaver-Burk type…
A: LB plot is double reciprocal plot which gives Km and Vmax values as x intercept and y intercept…
Q: What is anaerobic oxidation? 2. Which is the Hydrogen acceptor, Methylene blue or milk?
A: The removal of electrons is known as oxidation, and the gain of electrons is known as reduction.…
Q: Suppose that the pH of distilled water is 6.2, what will be its resulting color using phenol red.
A: The pH of a solution refers to the H+ ion concentration in the solution. A solution with a pH lower…
Q: d) Ninhydrin is used to turn amino acids in fingerprints purple, make a good way to stain…
A: Note: As per the guidelines, only the first two subparts are to be answered. Kindly resubmit the…
Q: What following statement is TRUE concerning motifs and domains? a) Both motifs and domains are…
A: The proteins are folded into their three dimensional structure in order to gain biological function.…
Q: Propose a pathway for the following compound to enter gluconeogenesis / glycolysis. In your pathway,…
A: The compound given is not a common biomolecule or metabolite. It is methanolglyoxal , the alcoholic…
Q: The figure below illustrates what reactions of amino acids? coo &C=0 CH₂ CH₂ 0=( 00 + NHⓇ NAD(P)H+H…
A: The amino group, carboxyl groups, and side chains of amino acids all play a role in how amino acids…
Q: 1. You were asked to prepare 1.0 L of a 0.10 M solution of sulfuric acid from a 3.0 M solution of…
A: Solutions of different concentrations of salts and acids need to be prepared for routine laboratory…
Q: Compare and contrast the principle behind DNA migration in agarose gel electrophoresis from that of…
A: Electrophoresis is a technique that involves the migration of charged molecules under the influence…
Q: Question 11 of 25 Among the given statements, which are characteristics of plant cells? Select the…
A: Osmosis is the process of net movement of water across a semipermeable membrane This transport…
Q: H3C CH3 -(HC- H₂ H₂ -C-C -CH2)3- Pristanic acid CH3 IL.
A: Pristanic acid is a branched chain fatty acid . It is 2,6,10,14 tetra methyl Penta decanoic acid.…
Q: Kwon Soon-young was asked by his CHEM 160.1 lab instructor to determine the isoelectric pH of an…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These…
Q: Indicate whether the following pairs of monosaccharides are aldoses or ketoses. a. D-altrose &…
A: INTRODUCTION : Monosaccharides : They are also known as simple sugar. They are the simplest forms of…
Q: One advantage of the protein structures solved by NMR comparing to the x-ray structures is: a. It…
A: Proteins are composed of amino acids attached together via peptide bonds. There are twenty standard…
Q: Briefly describe the role of glycoproteins as antigenic determinants for blood groups.
A: Glycoproteins are proteins with carbohydrates attached to it. The carbohydrates that are commonly…
Q: What is expected theoretical number of copies of DNA molecules after 28 cycles in a PCR experiment?
A: INTRODUCTION: DNA : Its fullform is Deoxyribo nucleic acid and It has a double stranded helix…
Q: ________ is a regulatory mechanism in which the end product of a metabolic pathway inhibits an…
A: Enzymes are biological catalysts. The enzymes, whose ability to catalyze a reaction depends upon…
Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Does glycolysis take place in the presence or absence of oxygen?
A: Glycolysis is a metabolic pathway which occurs inside the cell in which glucose is breaken down for…
Q: Tube 1: Add 1 mL 5% Trypsin Tube 2: Add 1 mL 5% Trypsin and 2 mL of 0.5% Na2CO3 Solution Tube 3: Add…
A: Trypsin is a proteolytic enzyme that cleaves the peptide bonds in protein and releases individual…
Q: Describe the biological functions of lipids. What factorscan affect the transition temperature (Tm)…
A: Lipid is a biomolecule which is soluble only in nonpolar solvents. They are hydrocarbons which…
Q: The side chain of which of the following amino acids is most hydrophilic a. Phe b. Val c. Leu d.…
A: The hydrophobicity or hydrophilicity of the amino acids in a protein is quantitatively analysed…
Q: Which of the following is true under the following conditions: an enzyme displaying Michaelis-Menten…
A: Enzymes are protein molecules that increase the rate of reaction by million times. Enzymes do not…
Q: Question 21 of 25 What are Gram-negative bacteria? Select the correct response(s): They have a cell…
A:
Q: True or False: Phosphoryl groups are added to enzymes to increase their activity. *If this…
A: The enzymes are biological catalysts that are mostly protein in nature. The activity of an enzyme…
Q: What does it mean if a compound is said to have “high phosphoryl transfer potential”?
A: ATP is known as the energy currency of the cell. ATPs are required by the cell for various reactions…
Q: In the free energy diagram below, molecule A (with energy x) is converted to molecule B (with energy…
A: Activation energy for a reaction is the minimum amount of extra energy that is necessary for the…
Q: If there is ample oxygen available, how many ATP can be produced from complete oxidation of glucose…
A: The aerobic breakdown of nutrients into carbon dioxide, water, and energy occurs during aerobic…
Q: Events that occur in the peroxisomes incluce the following EXCEPT oxidation of fatty acids…
A: Peroxisomes are small, membrane-bound organelles in eukaryotic cells that contain enzymes involved…
Q: Question 21 of 25 What are Gram-negative bacteria? Select the correct response(s): They have a cell…
A:
Q: Question 7 In the human body, under oxygen rich and oxygen poor conditions, respectively, pyruvate…
A: Respiration at molecular level refers to the process through which cells catabolize biomolecules…
Q: Discuss the role of carbohydrates on cancer and suggest an appropriate treatment
A: Carbohydrates are biomolecules, which are the primary source of energy for the body. All of the…
Q: Is there a reason why you divided the pKa's by 2 when determining the pI?
A: Isoelectric pH or pI is the pH at which the amino acid or the peptide is in zwitterion state.…
Q: 4. A single base addition and a single base deletion approximately 15 bases apart in the mRNA…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: Consider a uniport system where a carrier protein transports an uncharged substance A across a cell…
A: ∆G = R T ln (Ainside /Aoutside) Where G is free energy change for the transport of uncharged…
Step by step
Solved in 3 steps
- Which step in the processing of heterogeneous nuclear RNA (in eukaryotes), into mature messenger RNA, is required for proper attachment of the small ribosomal subunit to the mature mRNA molecule? polyadenylation at the 3’ end 7-methyl-guanosine capping at the 5’ end excision of introns formation of quadruple-stranded DNA splicing of exonsHemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. What effect on the polypeptide chain of factor IX would this new stop codon have?Heparin inhibits transcription by binding to RNA polymerase. What properties of heparin allow it to bind so effectively to RNA polymerase?
- Why is it essential that tRNA binds to both amino acids & mRNA codon during protein synthesis?Which of the following amino acids is carried by the tRNA that initiates translation in eukaryotes? a.Tryptophan b.Leucine c.Methionine d.AlanineWhich of the following amino acids is carried by the tRNA that initiates translation in eukaryotes? A. Alanine B. Methionine C. Tryptophan D. Leucine
- Which RNA processing event is facilitated by Serine 5 phosphorylation of RNA Polymerase II? Options: splicing RNA export polyadenylation recruitment to the Mediator condensate cappingAn RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg)Why and how does an antisense oligonucleotide functionally inactivate an mRNA for use in translation by a ribosome?
- The transcriptional complement of the DNA strand with the code 3’ TAA-CAT-GCT 5’ isMetenkephalin is a small peptide found in animal brains that has morphine-like properties. Give an mRNA sequence that could code for the synthesis of metenkephalin: Tyr-Gly-Gly-Phe-Met. Label your answer with 3′ and 5′ ends.How does C-terminal domain of RNA polymerase II function to ensure that the varoius sets of mRNA processing enzymes carry out their duties at the apporpiate time and place?