Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…
A: Answer: Central Dogma : It is the complete process of replication of DNA, transcription of DNA to…
Q: Order of Order of Order of Amino Acid bases bases in MRNA | (codon) bases Coded into in DNA in TRNA…
A: As we know DNA contains A T G C Bases and RNA Contains A U G C Bases. mRNA is complementary to DNA…
Q: How is a DNA nucleotide different than RNA nucleotide
A: Nucleic acids such as DNA and RNA, contain genetic information and information about protein…
Q: Which type of base pairs take the most energy to break in a DNA double helix? a. A-T base pairs b.…
A: DNA replication is a process in which DNA makes copies of itself with the help of the enzyme DNA…
Q: Adenine always pairs with
A:
Q: If a DNA strand has the sequence ATGCGATCCGC thenthe sequence on the complementary DNA strand is…
A: Answer is b.) TACGCTAGGCG.
Q: The keto form of 5-bromouracil will replace Thymine to base pair with Adenine. Which nucleotide will…
A: Nucleotides are organic molecules that contain phosphate groups and nucleotides. DNA and RNA are…
Q: Which of the following changes is a transition base substitution?a. Adenine is replaced by…
A: The correct answer is (c) Guanine is replaced by adenine.
Q: H. HD N. A N- H- H. 0=P-0- CH2 H. H. H. OH) H B. Where would this nucleotide hydrogen-bond to its…
A: Each nucleotide is a monomer of nucleic acid such as RNA and DNA. The RNA and DNA differs from each…
Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…
Q: DNA nucleotide base pairings: Thymine pairs with ___________________________, Cytosine pairs…
A: DNA is a nucleic acid made up of several units of nucleotides joined end to end. A nucleotide is…
Q: The building blocks of the DNA molecule are known as purines amino acids nucleotides polysaccharides…
A: Building block composition:[DNA] DNA entangled with chemical composed…
Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…
A: When DNA is converted into RNA then this is called transcription. When mRNA encodes protein then…
Q: A nucleotide is composed of all of the following excepta. 5-carbon sugar. c. 6-carbon sugar.b.…
A: Introduction DNA/RNA are nothing but the polynucleotide sequence composed of 5 basic nucleotides…
Q: If the sequence of one strand of DNA is written as follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write…
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: A codon consists of _ bases and specifies which will be inserted into the polypeptide chain. 4,…
A: The codon defines the relationship between a nitrogenous base sequence and the corresponding…
Q: If a molecule of DNA contains 42% thymine, then there is adenine, cytosine, and guanine.
A: DNA refers to Deoxyribonucleic acid. It is genetic material of almost all the organisms, except few…
Q: In the double helix of DNA, the ____________ bases of one strand exhibit complementary base…
A: The question asks about the helical structure of DNA in terms of complementary bases.
Q: Using the complementary base pairing rules in DNA, complete the following base pairs: 3D Adenine -i…
A: According to the complementary base pairing rule in DNA- Adenine and Thymine are complementary to…
Q: Three bases on MRNA that translate into an amino acid are called:
A: A translation is a process of conversion of mature mRNA molecules into long chains of a polypeptide…
Q: A DNA nucleotide triplet that codes for the amino acid alanine is a. CCA b. CGG C. CCU d. CGU
A: Introduction The molecule that carries the genetic information necessary for an organism's growth…
Q: If a protein was made up of 12 amino acids, how many nucleotides would make up the DNA message…
A: DNA( Deoxyribonucleic acids) is made up of two polynucleotide chain that winds around each other and…
Q: If DNA analysis of a gene shows it has 20% adenine (A), what percent of the other bases does it…
A: If you want any specific question to be solved, then please specify the number or only post that…
Q: true or false: a nucleotide’s 5 end provides the energy to synthesize a new strand of DNA.
A: Replication is one of the essential properties of genetic material because the progeny cells should…
Q: The chemical bond involved between the nucleotides in a polynucleotide strand is a _____________ .
A: Nucleotides are involved in the formation of DNA and RNA. It consists of a five-carbon sugar, a…
Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…
A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…
Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…
A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…
Q: Which base is found in DNA but not in RNA?a. thymineb. cytosinec. guanined. adenine
A: DNA is the molecule that contains the genetic code of organisms. It is composed of two anti-parallel…
Q: Amino Acids coded Order of Bases in DNA Order of Bases in Order of Bases in MRNA (codon) TRNA…
A: According to central dogma of molecular biology :- I ) DNA consists of two strand : coding and…
Q: The base content of a particular DNA molecule is 36% thymine. What is the percentage of each of the…
A: DNA consists of the bases adenine, guanine, thymine, and cytosine. These 4 bases together account to…
Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…
A: Answer
Q: Give me an example of nucleotide sequence with
A: According to Chargaffs rules of base pairing or nucleotide pairing are: A with T: the purine adenine…
Q: Which of the following amino acids is unique in that it can bind both non-specifically to the DNA…
A: All the protein that interact or bind with the DNA is called as the DNA binding proteins. These DNA…
Q: If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following…
A: DNA is the double stranded structure. Both strand is antiparallel to each other, direction of one…
Q: If one strand of a DNA double helix has the sequence GTCCAT what is the sequence of the other strand…
A: By the rule of complementarity, every A is bound to T and G is bound to C.
Q: A codon consists of _ bases and specifies which _ will be inserted into the polypeptide chain. 2,…
A: The nucleotide is the most fundamental component of nucleic acids. The polymers RNA and DNA are made…
Q: A DNA antisense strand contains the following nucleotide base sequence: ATC CAA GAC TGG From this,…
A: DNA refers to deoxyribonucleic acid. It is the genetic material of almost all organisms, except a…
Q: If one of the strands of DNA has the following sequence of bases running in the 5-S3'…
A: The given strand is: 5'-G-G-A-C-A-A-T-C-T-G-C-3` The complementary strand for the given sequence is:…
Q: Indicate the correct base order for the complementary DNA strand by placing the correct label in…
A: A DNA strand is formed of nitrogenous bases also called nucleobases. There are 4 nucleobases viz.…
Q: Which of the following base pairings is correct for RNA? A) U and T B) G and T C) C and U D) C and A…
A: Since there are multiple questions and they are not interlinked, as per our company guidelines only…
Q: A ___________ bond is formed by DNA ligase between the deoxyribose sugar of one nucleotide and the…
A: DNA ligase is a specific type of enzyme that facilitates the joining of DNA strands together by…
Q: Which of the following does not code for an enzyme having both helicase and nuclease activity?a)…
A: Genetic recombination is the exchange of genetic material between different organisms which leads to…
Q: A small segment of DNA has the following sequence: A – A – T – C – T – C – G – T – A The sequence…
A: DNA is a molecule composed of two polyneuclotide chains coiled around each other in a helical…
Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…
A: Complementary strands are two chains of DNA that make up the double-helical structure of DNA. The…
Q: Match the correct bases pairs to find the opposite strand of DNA strand of DNA - T G C…
A: DNA is deoxyribonucleic acid. It is the genetic material which is double stranded, which means it…
Q: A DNA nucleotide triplet that codes for the amino acid proline is a.
A: Answer: Amino Acids are the monomers of protein molecules which has both carboxyl and amino group…
Q: . The DNA strand whose %T is 50%
A: DNA Deoxyribonucleic Acid (DNA) is the genetic material of many organisms including viruses,…
Q: The nucleotide sequence of one DNA strand of a DNA double helix is 5’-GGATTTTTGTCCACAATCA-3’.What is…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: Fill in the blank with the most appropriate term that is described by the following statement:…
A: The components of DNA replication. A five-membered, oxygen-containing ribose sugar ring with three…
Q: Which of the following is not a nucleotide? a. adenosine triphosphate b. adenosine diphosphate c.…
A: Nucleotide is defined as a nucleoside linked to a phosphate group.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTCThe main function of t-RNA isa) Proof readingb) Inhibits protein synthesisc) Identifies amino acids and transport them to ribosomesd) NoneMultiple Matching. Fill in the blanks with the words below that apply.18. ________ site of protein synthesis19. ________ carries the codon20. ________ carries the anticodon21. ________ a process synonymous with mRNA synthesis22. ________ bacteriophages participate in this transfer23. ________ duplication of the DNA molecule24. ________ process in which transcribed DNA code is deciphered into a polypeptide25. ________ involves plasmidsreplicationtRNAconjugationribosometransductionmRNAtranscriptiontransformationtranslationnone of these PreviousNext
- 1. Search for the `P06858` a) Give information about the PTM and Processing of this protein. b) Which position has maximum amount of variations? Give details about the variations. (Eg: What kind of variation? Feature ID? Disease association? etc..)DO NOT COPY OLDER ANSWERS! AND SHOW FULL WORK! I have a mixture of 4 proteins, whose sequences are shown below (note that each protein is a 100-repeat of the sequence shown). Protein A: (Gly-Ala-Lys-Val-Ile-Phe-Glu-Val-Asn-Gly) Protein B: (Ala-Ala-Lys-Arg-Ile-His-Glu-Ala-Asn-Lys) Protein C: (Glu-Val-His-Asp-Ala-Asp-Glu-Val-Asn-Asp) Protein D: (Ala-Lys-Arg-Phe-Trp-Phe-Gly-Ile-Ala-Gly) 1) Which protein/s are MOST LIKELY to precipitate out at a pH of 3.5? a) A b) B c) C d) D e) B & C f) A & D g) None of them h) Cannot be determined.13.)Which describe the similarities and differences in the composition of DNA and RNA? a.)In DNA Thymine paired with Cytosine (T - C): In RNA Guanine paired with Cytosine (G - C) b.)In DNA Thymine paired with Adenine (T - A): In RNA Adenine paired with Uracil (A - U) c.)In DNA Guanine paired with Cytosine (G - C): In RNA Adenine paired with Uracil (U - A) d.)In DNA Thymine paired with Adenine (T - A): In RNA Adenine paired with Thymine (A - T) 14.)Most bacteria that cause sickness in humans grow best at 98. 6 degree Fahrenheit (37 degree Celsius). Sometimes a fever is the body’s response to the bacteria. What is the reason for developing a fever? a.)To make you feel miserable b.)Increasing the temperature of the body to kill bacteria c.)Decreasing the temperature of the body to kill bacteria d.) None of these 15.)The complementary base of Adenine in RNA. a.)Guanine b.)Thymine c.)Uracil d.)Cystosine
- https://cancer.sanger.ac.uk/cosmic/gene/analysis?ln=TP73 using the above linke, Briefly describe the most common mutation found in this gene. Include details about the type of mutation, and the predicted effect. . where does the mutation occur, what bases are changed; does the mutation change the protein sequence, and if so what would the likely biologics consequences be?Need help 1.The RNAs acting in RNAi are about 18 nucleotides long. To judge whether it is possible to uniquely target a particular gene with an RNA of this size, consider the following calculation: what is the expected frequency of occurrence of a specific 18 nucleotide sequence? a.The probability of finding this sequence is ___ . b.Therefore, the frequency of occurrence of this sequence is one in ___ nucleotides. c.The fruit fly genome consists of 1.2×108 base pairs.Using the logic in part a., calculate the minimum length of a unique DNA sequence expected to occur by chance just once in the fruit fly genome. Length = __ base pairsOptions , 1. RNA Pol I 2. Germ line 3. RNA Pol lll 4. Intragenic 5. Poly A polymerase 6. Inter- aka extra- genic 7. F' 8. Wobble 9. bypass supperssion 10. Amino acrylic tRNA synthtase 11. RNA Pol ll 12. Peptidyl transferase 13. SnRNP
- 10. Distinguish between:- a. Glycoproteins and Proteoglycans. b. SIRNA and MiRNA List the various types of eicosanoids. Explain their importance in the human body. What are co-enzyme, isoenzymes and functional plasma enzymes? Discuss the profile of enzyme and isoenzymes in myocardial infarction. What are the different structural organizations during packaging of DNA in a eukaryofic cell? What is meant by denaturation of DNA? Define hyperchromicity of denaturation? What are extracellular matrix proteins? List their functions. How has fluorescence microscopy contributed to one understanding of the nature of cytoskeleton? a. Nanoparticles and their applications b. Molecular chaperones What are heterotrimeric and monomeric G-proteins? Discuss their functions. Describe the effect of the following molecules on electron transport chain. a. Thermogenin b. Oligomycin c. Atractyloside d. BAL a. Briefly discuss Ramchandran plot. b. What is quaternary structure of proteins? Mention the role of…21. The difference between a nucleoside and nucleotide is: Group of answer choices 1. A nucleoside consists of the sugar with a nitrogenous base, whereas a nucleotide has a sugar with a nitrogenous base and phosphate groups attached to the sugar. 2. Nucleotides contain deoxyribose sugar and nucleosides contain ribose sugar 3. Nucleotides are involved in eukaryotic DNA replication, while nucleosides are used in bacterial DNA replication 4. A nucleotide consists of the sugar with a nitrogenous base, whereas a nucleoside has a sugar with a nitrogenous base and phosphate groups attached to the sugar.Hi all, If I could have questions 4-10 answered that would be perfect. GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the…