Options ,1. RNA Pol I2. Germ line 3. RNA Pol lll4. Intragenic 5. Poly A polymerase 6. Inter- aka extra- genic7. F'8. Wobble 9. bypass supperssion 10. Amino acrylic tRNA synthtase11. RNA Pol ll12. Peptidyl transferase 13. SnRNP A rare example of a[ Choose ]"ribozyme"Adds a tail to eukaryotic[ Choose ]MRNASAttaches amino acids to[ Choose ]TRNAImprecise nucleotide pairing,[ Choose ]but still worksInvolved in intron splicing[ Choose ]Main eukaryotic[ Choose ]transcription factor complex,contains TBPMakes mRNA (but not tRNA[ Choose ]or FRNA) in eukaryotesMutation in that can be[ Choose ]passed to your childrenMutant anticodon sticks to[ Choose ]UGA, UAG, or UAA (calledamber, ochre, or opal)Suppressor mutation is in a[ Choose ]different gene than originalmutation

Name: Options ,1. RNA Pol I2. Germ line 3. RNA Pol lll4. Intragenic 5. Poly
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Options ,1. RNA Pol I2. Germ line 3. RNA Pol lll4. Intragenic 5. Poly A polymerase 6. Inter- aka extra- genic7. F'8. Wobble 9. bypass supperssion 10. Amino acrylic tRNA synthtase11. RNA Pol ll12. Peptidyl transferase 13. SnRNP A rare example of a[ Ch

ribozyme is a ribonucleic acid (RNA) enzyme that catalyzes a chemical reaction. Poly A tail is the…

Science

Biology

1. RNA Pol I 2. Germ line 3. RNA Pol lll 4. Intragenic 5. Poly A polymerase 6. Inter- aka extra- genic 7. F' 8. Wobble 9. bypass supperssion 10. Amino acrylic tRNA synthtase 11. RNA Pol ll 12. Peptidyl

1. RNA Pol I 2. Germ line 3. RNA Pol lll 4. Intragenic 5. Poly A polymerase 6. Inter- aka extra- genic 7. F' 8. Wobble 9. bypass supperssion 10. Amino acrylic tRNA synthtase 11. RNA Pol ll 12. Peptidyl

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?
IF-2, IF-3, EF-Tu, EF-G and RF-1 are all involved in prokaryotic translation. List the roles of each factor in the process of translation--please be sure to note if the factor binds GTP. (You can list the factors with the function listed next to the factor.)
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?b. Scientists know the nucleotide sequences that directthe termination of bacterial gene transcription, butthey generally have little idea about the nature ofthe nucleotide sequences that direct transcriptiontermination in eukaryotic cells. Explain the basisof this statement.
Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′
The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).
Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for letters a and b: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu a. Using the table of the genetic code, determine the sequence of amino acids. b. If mutation occurs by substitution of the 12th nucleotide with cytidine-5’-monophosphate, what is the resulting amino acid sequence? c. What type of mutation occurred? Choose from same sense, missense and non-sense.
The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lys
. Eukaryotic processing of hnRNA into mature mRNA includes all of the following steps except: ribosome attachment of methionine to the 5’-AUG-3’ codon 5’-addition of a 7-methylguanosine cap 3’-addition of a polyadenylated tail splicing together of exons excision of introns
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.