Which statement describes the most likely outcome for the owl and toad populations in an environment in which skyglow and glare become factors?

Q: Explain why a loss or an excess in genetic material leads to the expression of an abnormal

A: Introduction :- Mutations are changes in a gene's DNA that are abnormal. Bases are the basic…

Q: Order the events leading to muscle contraction. Ca ions bind to troponin myosin binds to actin…

A: Muscle contraction It is defined as the muscles tightening or lengthening during performing an…

Q: Using the table below, differentiate the effect of two varying pH levels (as indicated by by the…

A: Enzymes are affected by changes in pH. The most favorable pH value - the point where the enzyme is…

Q: A hypothetical population was found to have a genotype frequency of AA=20%, Aa=40%, aa=40%.  If the…

A: The genotype of the population is a number of populations with the given genotype and is calculated…

Q: Canning   Given that the D65 for a particular micro-organism in a particular product is 12 min and…

A: Microbes, which are tiny and nearly invisible, have had a huge influence on society since the…

Q: A prominent scientist claims to have isolated mutant cells that can convert 1 molecule of glucose…

A: ATP is the energy currency of the cells that provide energy for endergonic processes.

Q: a gene insert itself into a bacterium’s Genome often distracting part of the genome. This is an…

A: Several types of techniques are incorporated in the molecular biology to get more desirable results…

Q: Based on today’s science and medicine, when does the age of viability begin? a. between 8 and 12…

A: The viability of a fetus indicates that the fetus has a survival chance. As soon as the fetus…

Q: of most hemoglobins when: 1. deoxygenated blood enters the capillaries in the lungs. 2. oxygenated…

A: Answer ::   Hemoglobin-oxygen dissociation curve as the name suggests describes the relation…

Q: The Klinefelter syndrome (disomy of the X chromosome in males) is a genetic disease caused by…

A: The normal humans contain 46 chromosomes. Between these 46 chromosomes, 44 are autosomes and 2 are…

Q: Post-transcriptional modifications in eukaryotic RNAS A. addition of CCA at the 5'end of the TRNA…

A: Post transcriptional modification is a process in eukaryotic cells by which newly synthesis RNA…

Q: Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles Ostriches Feathers…

A: In biology, evolution refers to the change in a species' features over numerous generations as a…

Q: You are supplied with the following information about a DNA molecule:  The molecular weight of a…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: v A compound required for precipitation of.DNA A. Carbonic acid v One of the products released when…

A: 1. A compound required for precipitation of DNA- B.Ethanol.   2. One of the product released when…

Q: economic and ecological significance of Barley (Hordeum)

A:

Q: Which of the following enables ions such as sodium to cross a plasma membrane? A. phospholipid…

A: Introduction Plasma Membrane:- These are also called the cell membrane, It is the outermost layer in…

Q: Why the synergy test results demonstrated that Penicillin G and Gentamicin did not act…

A: Penicillin G is an antibiotic that is used to treat bacterial infections. Pneumonia, strep throat,…

Q: In a population of 10,000 individuals, where 3600 are MM, 1600 are Mm, and 4800 are mm, what are the…

A: Allelic frequency means the rate of expression of a particular allele at a particular location in a…

Q: Most have well defined 3' ends terminating in poly(A) tails of - 200 nt. A prokaryotic mRNAs B…

A: The 3' ends of RNA transcripts synthesised by RNA polymerase II are produced bynthe endolytic…

Q: Which of the following is considered to be a spontaneous source of mutations that impa the genome? O…

A: ANSWER) (a) Fidelity errors during replication Spontaneous mutation is described as the alterations…

Q: What makes food palatable or unpalatable?

A: Introduction The palatability of food is a hedonic reward provided by foods or fluids that are…

Q: Crossing over gives genetic and happens during the stage of meiosis I.

A: Cell division happens when a parent cell divides into two or more daughter cells.  There are two…

Q: Which of the following are examples of kinetic energy? A. protons moving through ATP synthase, ATP…

A: Cellular Respiration is a metabolic phenomenon in which glucose is used up in order to liberate…

Q: Bacteria that thrive in puncture wounds are likely to be (a) aerobes (b) photoautotrophs (c)…

A: Aerobes are the organisms that live and reproduce only in the presence of free…

Q: identify the taxonomy of the dinosaur from the skeleton and identify the features or characteristics…

A: Michael Benton classifies all dinosaurs within the Series Amniota Class Sauropsida Subclass Diapsida…

Q: does chain abberation due to translocation mutation result to fertile gametes

A: Translocation is a structural change in the chromosome and includes the exchange of chromatin…

Q: (Select one answer from dropdown menu and fill in the blanks:) When a sperm and an egg cell called a…

A: The mechanisms that work to stimulate or suppress the transcription of a gene are referred to as…

Q: The diversity of modern vertebrates was shaped in partby mass extinctions. The most severe…

A: Mass extinctions refer to the elimination of a large number of species from the earth in a short…

Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…

A: When there is an error in the DNA sequence during replication it causes a change in the DNA…

Q: QUESTION 15 Which of the following does not change gene frequencies in populations? selection O…

A: Introduction :- The relative frequency of an allele (gene variant) at a specific locus in a…

Q: Primase has the important role of removing the RNA primers and filling the gaps with new DNA…

A: DNA replication There are number of processes necessary for the continuation of generation, growth…

Q: 2 5

A: The digestive tract of pigs is monogastric or nonruminant. It is similar to humans as monogastric…

Q: Iti do a cohort study on some new cute animal, and I discover that most of the individuals die at a…

A: Cohort study is a type of longitudinal study that follows research participants over a period of…

Q: make glucose and the oxygen is released as molecular oxygen.        If you do the math how much…

A: In photosynthesis green plants use energy from sunlight  to convert atmospheric carbon dioxide and…

Q: What are the environmental climatic and bio-physical requirements of lowland rice

A: Answer :- Rice crop needs a hot and humid climate. It is the most appropriate to districts which…

Q: This process involves plastocyanin.

A:

Q: SARS-CoV-2 spreads through cell-to-cell transmission

A: Introduction Covid 19 is a coronavirus-caused acute respiratory infection in humans that can cause…

Q: . Why is the relationship P=p2 used for homozygous loci?

A: Introduction :- Homozygous for a given locus refers to diploid and polyploid cells that have the…

Q: True or False: 1. There is the bidirectional mode of replication during S-phase.  2. Single strand…

A: The replication is the process of new DNA synthesis from the old DNA template by semiconservative…

Q: GEL ELECTROPHORESIS What is the purpose of gel electrophoresis?…

A: DNA, RNA and proteins are macromolecules. There are different techniques to separate them.

Q: Knowing how the photosynthetic process proceed, what do you think would be some of its…

A: Introduction Photosynthesis is a process through which plants and other organisms transform light…

Q: 2. During what phase does DNA replication occur in? (Select one answer from dropdown menu:) Choose…

A: DNA replication is semiconservative in nature, where each daughter DNA molecule has one parent…

Q: Order the events leading to the sperm's nucleus fusing with the egg's nucleus.   Question 1…

A: Fertilization is defined as the union of sperm and ova. Fertilization leads to formation of zygote.

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Given the scenario, compute for the total volume of the culture media solution (milliliter or liter)…

A: We have been given the concentration of the nutrient broth and Agar and we have also been given the…

Q: With a diagram trace the movement of electron during the LRP of photosynthesis.

A: Photosynthesis is a process in which carbon dioxide and water is used up as raw material along with…

Q: Protein secondary structure pricipally arises from A H-bonding of backbone atoms in peptide groups…

A:

Q: TRUE or FALSE? Sexual selection can only occur if the features and/or behaviors associated with it…

A: Natural selection is the interaction through which populaces of living beings adjust and change.…

Q: Explain the difference between resolution and mag­nification.

A: Introduction :- The term'resolution' is used in microscopy to describe a microscope's ability to…

Q: the adaptations that Orobanchaceae (plant) has evolved to invade and manipulate the hosts (talk…

A:

Ecological adaptations

An ecological adaptation is any morphological, physiological, or behavioral trait of an organism that allows it to survive and reproduce in a habitat or ecosystem. Adaptation is a biological mechanism by which an organism gradually gets more acclimated to its surroundings.