Q: trace the wastewater treatment (from incoming water to release) in a typical plant that handles…
A: Wastewater cause a demand for dissolve oxygen and water turbidity is also increase. To resolve this…
Q: (b) Ah Keong stores imported mutton stock in the refrigerator to maintain the freshness prior to be…
A: Given Ah keong stores imported mutton stock in the refrigerator to maintain the freshness:-…
Q: Classify the following viruses according to Baltimore classification by completing table. Virus:…
A: Introduction Smallpox is a caused by the variola virus. It is highly contagious and serious…
Q: Create a Bracketed dichotomous key from the table Plant Types of plant (Flowering or non-…
A:
Q: Describe the differences between suspended growth and supported growth in a fermentation system.
A: Introduction The metabolic process of fermentation involves the action of enzymes to cause chemical…
Q: A glycocalyx functions in all of the folowing ways EXCEPT: a) adherence to non-living surfaces, such…
A: A glycocalyx is a loose sheet present around the bacteria cells.
Q: Select all statements that correctly describe hemoglobin and myoglobin structure. By itself, heme is…
A: Introduction Myoglobin stores oxygen, whereas haemoglobin transports it. Red blood cells found in…
Q: Owen below Dome Statement about fish post Poisoning in which Statement Encerning dcomborid fish…
A: Answer :- The option 3 is incorrect because symptoms are usually occurs within 1-24 hours. Scombroid…
Q: Mapping a new mutation on the same chromosome as the mapping genes: Scenario 1 1. If the m mutation…
A: The genotype is the genetic makeup of an individual, while the phenotype is the physical appearance…
Q: Why is there a difference in the proportionate number of plants in each phenotypic class of the…
A: During gamete formation, different types of gametes segregate independently from each other. Here,…
Q: What are second messengers? How do they function? Be familiar with cAMP and calcium ions as common…
A: Signal transduction is the process in which signaling molecules bind to their receptors.
Q: White color (W) in cattle is dominant and brown color (w) is recessive. A farmer had a white bull.…
A: Alleles are the variants of a gene. In diploid organisms, there are two copies of each gene.…
Q: A virus infects a cell of the body. This will most likely be destroyed by: 1) antibodies 2)…
A: Viruses are responsible for hijacking the host's cellular system. Our immune system is capable of…
Q: [ Discuss and react. ] Maximum of 4 sentences. Give science-based arguments. Bt corn directly…
A: Bt Corn (Bacillus thuringiensis) is a genetically modified crop, which is produced by introducing…
Q: 2. To tube 1, add 10 μl of 50:50 AT:GC DNA (tube B). 3. Add 5 μl of Buffer to tubes 2-7. 4. Remove 5…
A: The results of a polymerase chain reaction (PCR) are significantly influenced by the overall amount…
Q: hich process occurs in meiosis but does not occur in mitosis? 1.synapsid of chromosomes…
A: A parent cell replicates its chromosomal material and divides into two daughter cells during the…
Q: ● What cellular signaling molecule (mediator) is released to activate T lymphoc "stage 1"; ● ● ●…
A:
Q: (b) List TWO (2) types of common food hazards. Describe the properties of bacteria endotoxin based…
A: a)Two types of food hazards 1)Biological hazards :- embody bacterium, parasites, fungi and viruses.…
Q: What is crossing over and where does it occur in meiosis? Why is crossing over important for…
A: When a mother cell divides into two or more daughter cells, a parent cell has undergone the process…
Q: Question= Which of the following is most likely to increase the effective size of a population? 1.…
A: Introduction :- The population of a place is the total number of humans or animals living there.…
Q: Answer the given questions, kindly draw a clear illustration of the given. Follow the instructions.
A: The plasma membrane is acted as a capacitor. It contains non-conducting components i.e. hydrophobic…
Q: A botanist two diferen took trans Specimens s microscope Leat from Plant 1 с CC . P The plants а…
A: Stomata are the cell structures which are pore like found in the epidermis of leaves, stems etc.They…
Q: The allele for color-blindness is carried on the X chromosome. Making color blindness (a recessive…
A: The inability to identify certain colour distinctions is known as colour blindness. The retina, the…
Q: How applications of CRISPR-Cas technology is used ?
A: A group of DNA sequences known as CRISPR can be discovered in the genomic of prokaryotic organisms…
Q: Which four kinds of tissues arranged in various proportions and patterns?
A: One of the main structural groups in all animals is tissue. The cells that make up tissue are…
Q: why is testing known inhibitors of viral proteases from other viruses a logical first step in…
A: Protease in Corona virus cleaves the polyprotein in virus at 11 conserved sites. It is a kind of…
Q: What factors affect the stress response?
A: The stress response is a complex process that is regulated by many different factors. These include…
Q: 5. Which of the following is NOT true about polypeptides? The peptide bond that links the amino…
A: Polypeptide is an unbranched chain of amino acids. Amino acids are linked together by peptide bonds.…
Q: Greg and Susan have Nail- Patella syndrome (NPS). NPS is an autosomal dominant. Greg has a blood in…
A: Introduction The nails, knees, elbows, and pelvis are abnormal in people with nail-patella…
Q: How can the yeast vector, YEP, containing your desired gene, be inserted into the host cell? Discuss…
A: YEp stands for Yeast Episomal plasmid is a shuttle vector. Shuttle vectors are vectors designed in a…
Q: How did the colonists adapt to their natural environments
A: Introduction: The 'natural environment' refers to the non-human-made surrounds and conditions under…
Q: Assume that the molecular clock for the alcohol dehydrogenase (Adh) gene in Drosophila ticks at a…
A: molecular clock for the alcohol dehydrogenase (Adh) gene in Drosophila ticks at a rateof 5 X 10%…
Q: Name of virus Herpes viruses RNA or DNA Double stranded (ds) or Single Stranded (ss) Linear or…
A: The first-generation herpesvirus, Herpes simplex virus type 1 (HSV-1), has a linear double-stranded…
Q: 15-16. In the fruit fly, vestigial (tiny) wings and hairy body are produced by recessive genes. The…
A: Drosophila is a genus of flies in the family Drosophilidae. Because many species tend to stay around…
Q: What are the functions of the ANS?
A: Autonomic Nervous System There are three physically separate divisions in it: enteric,…
Q: (Q032) Which of the following statements about conditional alleles is FALSE? O Conditional alleles…
A: When coupled with a tissue-specific Cre recombinase, conditional alleles in genetically altered mice…
Q: What role do mutations play in the fragment presented above? How is the mechanism of natural…
A: The abrupt changes in the DNA sequence is called mutation.Iit could be beneficial, harmful or…
Q: The cardinal has the scientific name Cardinalis cardinalis. The scientific name contains which…
A: Answer : the cardinals cardinals are at the super class level of the taxonomic level. They are…
Q: Write TRUE if the statement is correct, FALSE if otherwise. JOOHOB OBTAROSTI 11. Food undergoes…
A: Since you have asked a question with multiple subparts, we will answer only first 3 subparts for…
Q: 3. The promoter region contains a consensus sequence where transcription factors bind to initiate…
A: 1) For the initiation of transcription, the RNA polymerase enzyme needs to enter in between the DNA…
Q: II III 2 I 1 2 3 ото 1 2 до 8 3 4 5 4 5 что 6 7 6 7 8 9
A: Introduction :- Cystic fibrosis is brought on by a mutation in the CFTR gene (cystic fibrosis…
Q: O Males and females are affected equally Question 26 Which of the following is a sex-linked…
A: Introduction Genetic disorders are of two types, sex linked and autosomal. Sex linked disorders are…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'
Q: Why is it that some cells can produce action potentials and others cannot?
A: Action potential is defined as the electrical signal that is produced by the neuron when it is…
Q: How might overexpression of proto-oncogenes lead to abnormal cellular proliferation?
A: There are many ways in which overexpression of proto-oncogenes can lead to abnormal cellular…
Q: The genes for ruby eyes (rb), tan body (t) and cut wings (ct) are all found on the X-chromosome of…
A: If the genes are located on the same chromosome then they are classified as linked genes. In the…
Q: Which of the following is an example of a genotype? DNA Protein O AaGG Head size
A: Genotype: The genotype of an organism is the particular arrangement of alleles for a particular…
Q: How are different touch receptors distributed over the body?
A: We realise that we have uneven distribution of touch receptors in the skin; some locations have many…
Q: structure of GLB-1 with haemoglobin and myoglobin, describe in detail why and how GLB-1 has…
A: Beta-galactosidase-1 is an enzyme that aids in the breakdown of lactose while hemoglobin and…
Q: dominant that is 80% penetrant. Clara inherited her polydactyly from her mother, her father had no…
A: 80% penetrant means that in spite of the presence of the dominant allele still 20% people would not…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given our knowledge of genome sizes in different organisms, would you predict that Homo sapiens or the two-toed salamander (Amphiuma means) has the larger genome?Why are bananas, seedless watermelons, and potatoes genomes so unusual? What is the purpose of the Human Genome Project? Why do researchers want to know the details of the human genome?
- Would you expect the genome of the macaque(a monkey) to be more like that of a mouse or thatof a human? Explain.What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?what is the role of gene duplication, whole genome duplication, transposable elements, and horizontal gene transffer in genome evolution?
- How Human Genome Project proved important for Genome Organization in Humans ?Why do scientists want to sequence the human genome?The Japanese canopy plant (Paris japonica) has one of the largest of all eukaryotic genomes, with approximately 150 billion base pairs, about 50 times the size of the human genome. In contrast, the bladderwort Utricularia gibba has one of the smallest plant genomes, with only 82 million base pairs. What predictions can you make about the genomes of these two species?
- What is the most surprising result found thus far in the human genome studies?What are the types of transposons? Please explain in detail how transposons contribute to genome evolution.What are the big differences between eukaryotic (nuclear) and prokaryotic genomes? How do prokaryotic genomes compare to the genomes found in eukaryotic organelles? Why?