Why do some scientists use immersion fluids when looking at their microscope slides? Increases the working distance Keeps the sample alive Collects a narrower band of light Takes advantage of lower refractive index Increases the numerical aperture

Why do some scientists use immersion fluids when looking at their microscope slides? Increases the working distance Keeps the sample alive Collects a narrower band of light Takes advantage of lower refractive index Increases the numerical aperture

Comprehensive Medical Assisting: Administrative and Clinical Competencies (MindTap Course List)

6th Edition

ISBN:9781305964792

Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa

Publisher:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa

Chapter38: Introduction To The Medical Laboratory

Section: Chapter Questions

Problem 6CR

See similar textbooks

Related questions

Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…

A: Definition of Synapse: The specialized junction at which a neuron communicates with a target cell…

Q: Explain how each of the following tests for syphilis is best used by describing what each tests for…

A: RPR (VDRL) is test for screening syphilis. RPR stands for Rapid Plasma Reagin and the abbreviation…

Q: I XHXh| XhY 2 XhY XhXhY A) If the nondisjunction event that gave rise to Il-2 occurred in the…

A: X-linked recessive disease X-linked recessive allele contains two words that are "X-linked" and…

Q: what structure is present in both plant and yeast cells, but not in a bacterial cell?

A: Introduction :- Yeasts are single-celled fungi that produce daughter cells either by budding…

Q: Metabolic syndrome is a clustering of various conditions including high blood pressure, high blood…

A: Metabolic syndrome is a group of disorders that occur in tandem and increase your risk of heart…

Q: in 250 words and in own words Explain the role of the components of a spinal reflex arc.250 words…

A: A reflex arc is defined as a neural pathway that controls a reflex. The usual pathway would have…

Q: You are studying a cell line that expresses both GPCR-A and G <-B, each receptc binds the same…

A: GPCR A increases cAMP and GPCR B decreases it. Hence any mutation affecting the GPCR B will be…

Q: 6. a) What is meant by the term "symbiosis"? [K/U] b) Give an example for each type of symbiosis and…

A: Animals breathe in oxygen and exhale carbon dioxide during the process of respiration. Plants, on…

Q: Certain cells in the retina respond differently to the direction in which objects move. To…

A: A retinal ganglion cell (RGC) :- is a kind of neuron which is found near the inner surface of the…

Q: You take a sample of cancerous tissue from Individual II-6 from the prior question. What will the…

A: X- linked inheritance X linked inheritance is a pattern of inheritance when the trait is controlled…

Q: Analysis of urine is routinely used in medical screening. The presence of glucose in the urine is…

A: In a healthy person the kidney excretes waste materials of body . Kidneys don't excrete essential…

Q: How does temperature and PH affect the activity of enzymes.

A: Introduction Enzymes function as catalysts. Proteins are the most common, although some RNA…

Q: Explain why STR mutations are found at a much higher frequency than single nucleotide changes?

A: STR means single tandem repeat, and the mutation in the STR segments is at a very high rate .

Q: Differentiate flexion from torsion. Why do these events occur in the developing embryo?

A: Answer--

Q: 2. Calculate the following: a. you are asked to prepare 10 NA slants and 5 NA stab in big tubes. How…

A: Growth media also known as culture media are used to cultivate microorganisms. These media are a…

Q: 1. A color-blind man married a normal woman. Their daughter, who was phenotypically normal, married…

A: XC = normal X chromosome Xc =Color-blind X chromosome 1). first cross A color-blind man(XcY) X a…

Q: A. You are crossing bunnies. The haplotype of a female bunny, Poppy, is as shown in the diagram…

A: In its broadest definition, a haplotype is a collection of DNA changes along a chromosome that tend…

Q: ATP synthase is a protein that catalyzes the formation of the energy storage molecule adenosine…

A: Given: ATP synthase is the protein that catalyzes the formation of the energy storage molecule…

Q: Choose the answer that best describes Allopatric Speciation. evolution that occurs when populations…

A: Allopatric speciation occurs when a population becomes isolated from those other populations due to…

Q: This is about ecological sampling methods in estimating plant cover. Define the following: cover,…

A: Plant cover in ecology is used to measure the abundance of plant species in a relative area covered…

Q: Did you have an experience when a stranger acted caring and was helping you? What impact did that…

A: Empathy creates a connection that enables us to feel compassion. We can sense the suffering of…

Q: A sealed greenhouse that allows sunlight through the windows but prevents water or vegetation from…

A: A greenhouse is a self-designed structure having walls and roofs made up of transparent materials…

Q: You are recording from a touch receptor in skin. When you stimulate a spot on the skin, the receptor…

A: Answer :- Option (B) is correct. - Whether the receptor sends its output to the somatosensory cortex…

Q: The ff. mothers, (A) through (E) with given phenotypes, each produced one child whose phenotype is…

A: This question can be done by splitting each trait and crossing the concerned trait of mother and…

Q: Create an artwork portraying the prokaryotic cell (one for archaea and one for bacteria). Explain…

A: Both Archaea and Bacteria are unicellular organisms. In this way they are different from eukaryotes,…

Q: In certain regions, monk seals overturn rocks to catch prey underneath. But nearby sharks often…

A: Introduction Ecological interactions:- It is the relationship between two different or the same…

Q: (Select one answer from dropdown menu and fill in the blanks:) When a sperm and an egg cell called a…

A: The mechanisms that work to stimulate or suppress the transcription of a gene are referred to as…

Q: give an example of creation myths in the philippines stories

A: Introduction Philippine mythology is a collection of stories and epics derived from and incorporated…

Q: Across plant thr Shawnee believe caused milk sickness

A: Introduction Tremetone is a chemical compound found in tremetol, a toxin combination derived from…

Q: The proteins work together to cause the release of the transcription factor that is bound by the…

A: Answer is D p53

Q: 13 15 DSS karyotic organisms that cause infections eases that can't be caught (passed from person to…

A: Disease is a state of illness which could be contagious that is spread from person to person or…

Q: what is known as the growth center of the bone

A: Introduction :- In most vertebrate animals, a bone is a rigid organ that is a part of the skeleton.…

Q: Question 64 The vertebrates that lack jaws are called O rays. O turtles. O lampreys. O eels. MacBook…

A: Since you have asked multiple questions from different topics at a same time we will answer only 1st…

Q: 1. Differentiate between prokaryotic and eukaryotic cells? 2. In your view, which cellular organelle…

A: Introduction Cell:- It is a mass of cytoplasm that is bound externally by a cell membrane, It is the…

Q: Give economic and ecological significance of Corn (Zea)

A: Zea It is commonly known as corn. It is a cereal grain. The plant has a leafy stalk which have…

Q: 9. Suppose you accidentally introduce a small plant-eating beetle into your self-contained…

A: You construct a self-contained ecosystem in a jar, following some instructions. Your ecosystem…

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

Q: Compare monocot, herbaceous dicot and woody dicot stems. Indicate presence or absence of the…

A: Introduction Monocot stem refers to the stem of the monocot plants, it is a circular-shaped hollow…

Q: (Select one answer from each dropdown menu and fill in the blank:) In meiosis, the goal is to get…

A: Meiosis is the reductional cell division where four daughter cells are produces with haploid number…

Q: Besides the Warrior gene, the only other genetic mutation directly correlated with “super-maleness”…

A: As mentioned in many scientific literature the warrior gene which is normally referred to as MAOA…

Q: Discuss the physical structure of either a forest or a lake, and explain how the physical structure…

A: Lake is an open body of shallow depression containing water usually freshwater. Different types of…

Q: Directions: Based on the analogy of light reactions. Describe the pattern of the electron flow…

A: The initial phase of photosynthesis is the light reaction, that converts sunlight into chemical…

Q: Describe the enzymatic reaction of the protein epidermal growth factor. Include the specific…

A: Epidermal growth factor is a protein, involved in cell cell proliferation and differentiation, by…

Q: Explain the various anthropogenic causes of the water cycle.

A: The water cycle, also hydrological cycle or the water balance, is the continuous water flow on,…

Q: A cladogram or phylogenetic tree is used to classify organisms into groups based on their shared…

A: A cladogram or a phylogenetic tree is a type of evolutionary tree showing representation or…

Q: which protein interacts with RNA polymerase, in order to allow RNA polymerase to cleave RNA using…

A: SII a protein, interacts with RNA polymerase, in order to allo RNA polymerase (ll mainly) to cleave…

Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…

A: Cellular respiration, like burning, results in the complete oxidation of glucose into CO2 and water.…

Q: What is the significance of Juxtaglomerular apparatus in kidney function.

A: Introduction - The kidneys are two bean-shaped organs located on either side of your spine, below…

Q: Question z Methanogens are always engaged in relationships with other microbes because methane…

A: Answer- interspecies hydrogen Transfer. Interspecies hydrogen transfer (IHT) is a form of…

Q: The distinction between SLA and HDD may be explained as follows:

A: Disease It is a particular abnormal condition that negativity affects the structure or function of…

Question

Why do some scientists use immersion fluids when looking at their microscope slides?

Increases the working distance

Keeps the sample alive

Collects a narrower band of light

Takes advantage of lower refractive index

Increases the numerical aperture

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Introduction-

VIEW

Explanation-

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

A microscope that maintains focus when the objective magnification is increased is calleda. binocular.b. myopic.c. parfocal.d. refractive.e. resolute.
The best description of N microscope objective lens is .... it is concave it is scattering it is converging it has an unknown focal length
It is desirable that the microscope objectives be parfocal because the specimen will be .................. a)blurry due to the changes in the refractive index of the medium b)stay in focus when the light is turned off c)have more contrast and enhanced details d)remain in focus if the magnification is changed e)none of the answer choices
A student using a microscope measured the low power field diameter to be 7.1mm. The student then switched from the low power (4x) objective lens to the medium-power (10x) objective lens. Assuming a 10 x ocular (eyepiece) lens, the medium power field diameter is ____ um um is micrometers
As with standard phase contrast microscopy,differential-interference contrast microscopy depends on differences in the ___________________ of a speciment to create high-contrast images. a. refractive index b. light absorption c. natural fluorescence d. walls and coverings e. natural pigmentation
You have a microscope equipped with 10 x oculars and 4 objectives, which exhibit the following characteristics (M, NA): Tick the right answers:o Objectives B and C are equivalent.o Objective D will allow more detailed observation than objective C.o To see small structures, you should choose objective D rather than C.o Objective D has a lower resolution than objective C.o To observe large objects, it is better to use objective B rather than objective C
A microscope that has a total magnification of 1,500× when using the oil immersion objective has an ocular of what power? a. 150× c. 15× b. 1.5× d. 30×
What is the importance of using an immersion oil in 100x magnification? Describe the changes in the field of view and the amount of available light when going from low to high power using the compound microscope. Give some limitations in the use of microscope. Conclusion about microscope
The resolving power of the microscope reveals: a. Whether or not oil is needed to see a microorganism. b. The maximum magnification possible with a particular objective. closely spaced objects to be seen clearly. c. Two closely spaced objects to be seen clearly. d. The magnification capacity of the microscope E.the amount of clearance between slide and objective lens.
Which of the following statements is FALSE? Question options: increasing wavelength improves ones ability to view microscopic structures increasing resolution can improve ones ability to view microscopic structures increasing magnification can improve ones ability to view microscopic structures all of these statements re TRUE increasing contrast can imporove ones ability to view microscopic structures oil immersion can increase the resolution of light microscopes
Match the following items: [4] 1. 540 nm A. Wavescan 2. Quantity of light of a specific wavelength absorbed by a sample B. Standard series 3. Reference samples with a concentration range C. Absorbance 4. Absorbance values at all wavelengths D. Purple
Which statement(s) describe(s) a microplate reader?A. It is spectrophotometerB. It can read the absorbance of one sample with adjustable path lengthC. It can handle multiple samples in parallelD. It will do all measurement jobs without our supervision a. A & B b. A, B & C c. A, B, C & D d. A e. A & C