Why is important to note the Kit / Lot number and expiration date for each kit or tests done from each ELISA kit?
Q: Thiophene ring contains ------- as heteroatom.
A: Thiophene is a compound with ring structure, in which there will be atoms of two or more different…
Q: In the case of autosomal recessive mutations, the frequency of the disease in a population is…
A: Autosomal recessive inheritance It is a particular way of genetic trait or condition which can be…
Q: The DNA and associated proteins of a eukaryotic chromosome are called Chromatin Chromatosome…
A: Eukaryotic chromosomes are made up of DNA that is tightly coiled around histone protein clusters.…
Q: In monounsaturated fatty acids, the presence of a double bond is usually found at the position…
A: Depending on the presence of double or single bond the fatty acids are classified as unsaturated and…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Briefly describe the following and give examples. 1. Monosaccharides 2. Disaccharides 3.…
A: 1. Monosaccharides - they are simple carbohydrates that consist of a single polyhydroxy aldehyde or…
Q: In the RBCs of the patient described in the picture, which of the following would be expected?…
A: Glycolysis occurs in both aerobic as well as anaerobic respiration. Glycolysis is the only…
Q: 3. Do enzymes act better under acidic or alkaline pHs?
A: Most favored pH value - the pH point where the enzyme has most activity - is known as the optimum…
Q: In bacteria, single polycistronic mRNA encodes for: a single mRNA which is split into…
A: Polycistronic mRNAs are those that code for many polypeptides from a single mRNA as it involves…
Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT: a. GRE b. MRE c. GC Box d.…
A: Metallothioneins are proteins that have high affinity towards binding heavy metal ions, and its…
Q: Which of the following molecules is NOT an amphipathic? phosphatidyl choline cholesterol…
A: Amphiphatic are the molecules which contain both hydrophobic as well as hydrophilic in their…
Q: describe the structural features of protein transaminase/aminotransferases (primary, secondary,…
A: Hi! Since you have posted multiple questions and have not mentioned which to answer , we are…
Q: 5. Salivary a-amylase cleaving a(1 example for which type of specificity? a) Group specificity b)…
A: Group specificity : Enzyme will catalyze the reaction on a function group of different molecules…
Q: Unsaturated fatty acids have ----. Question 16 options: multiple amide groups in their…
A: Fatty acids are the simplest form of lipids and serve as constituents in a large number of complex…
Q: Make a flow chart of Protein Digestion, Absorption and Nitrogen Excretion. Indicate the organs,…
A: In process of digestion, complex molecules are converted to simple molecules…
Q: Genetically modified cotton plants produce the toxin encoded from the gene originated from the…
A: Any organism whose genetic material has been altered using genetic engineering techniques is…
Q: What information can be inferred from this graph? 250 200 Diabetic subject 150 100 Normal subject 50…
A: The liver and the pancreas act together to balance blood glucose level. When the pancreas can sense…
Q: Give the lipid number for the following fatty acid:
A: The numbers are typically presented in the following template = (number of carbons in fatty acid…
Q: Which of the following is required for RNA splicing to occur? a 2´ hydroxyl group a free 5´…
A: Introduction: Eukaryotic genes often contain intervening sequences called introns that separate the…
Q: Question Which of the following activities of DNA pol lis MOST important in proofreading A 5' to 3'…
A: The DNA replication in the newly added base are read by DNA pol I enzyme to check weather the added…
Q: Does oxidase, catalyzes the oxidation of molecular oxygen? True or False
A: Enzymes are biological catalysts that are proteins. Chemical reactions are sped up with catalysts.…
Q: The Human genome project used the following methods Shotgun Sanger Both None
A: The Human Genome Project : It was an international effort to find the DNA sequence of the complete…
Q: 3. A biochemist purified a protein from the bloodstream and determined its molecular weight under…
A: The quaternary structure of a protein describes the association of polypeptide chains or subunits…
Q: gel electrophoresis
A: Gel Electrophoresis is a simple , rapid and analytical technique which is used for separating the…
Q: Determine the vitamin content of the following fruits and vegetables using…
A: Introduction: Vitamins are organic compounds present in food that are needed in minimal amounts for…
Q: H1. Estimate the TKN associated with a sample having 50 mg/L of cell tissue and 10 mg/L of ammonia.…
A: TKN (Total Kjeldahl Nitrogen) test is a method of estimation of total concentration of organic…
Q: You are supplied with an unknown protein that consists of more than 130 amino acids. Furthermore…
A: Proteins are the most abundant biomolecule constitutes nearly 75% of the total body weight. Proteins…
Q: Fluorescent proteins like the green fluorescent protein (GFP) found in jellyfish are a class of…
A: Proteins are composed of different types of amino acids (polar charged, polar uncharged, and…
Q: Identify the monosaccharide below
A: Carbohydrates are largely composed of carbon and water, and most of them have the empirical formula…
Q: Answer the ff. questions: 1. What factors influence the metabolic rate of citrate in the…
A: The acetyl group of acetyl CoA is bonded to a four-carbon oxaloacetate molecules to generate a…
Q: CH2OH но но- ÓH CH2 но но. но он
A: Sugars are made up of carbon, hydrogen, and oxygen in the ratio of 1:2:1. Sugar molecules are also…
Q: 9. Which of the following enzyme catalyzes a reaction that introduces reduced nitrogen ito cellular…
A: Nitrogen metabolism is an important process in bacteria through which nitrogen is assimilated into…
Q: Aside from gel electrophoresis Give another method to quantify DNA. Explain the concept behind this…
A: DNA quantification is a type of quantification of nucleic acids that is used for the determination…
Q: Diets aimed at reducing coronary heart disease should be:
A: Coronary heart disease which is also called as coronary artery disease or myocardial ischemia or…
Q: Explain in complete manner why these 3 became the major pathway that eventually become the entry…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: A glycogen polymer and an amylopectin polymer, each containing 100 monosaccharide subunits, are…
A: Amylopectin and glucogen are examples of branched polysaccharides.
Q: 2. What are the names of the 3 different isomerase enzymes that appear in glycolysis, and write them…
A: Glycolysis is a metabolic pathway in which glucose is break down into two pyruvate in several steps…
Q: Intrinsic RNA chain termination is determined by specific sequences in the DNA called ____ sites.…
A: Termination during transcription occur via 2 methods. Intrinsic termination:- promote termination by…
Q: (a) Identify a phospholipid from the list of compounds shown above. __________ (b) Identify a…
A: Answers: (a) Identify a phospholipid from the list of compounds shown above. __________ Answer:…
Q: Explain how ATP levels regulate glycolysis in resting muscle
A: Glycolysis is a catabolic pathway in which carbohydrates are oxidized to two molecules of pyruvate.…
Q: Protein denaturation is the disruption of a protein's secondary to quaternary structures. Protein…
A: Denaturation is a process in which proteins or nucleic acids lose their native quaternary, tertiary,…
Q: How does the liver maintain a safe level of blood glucose during a normal 24-hour day?
A: The liver serves as the body's glucose or fuel reserve, assisting in the maintenance of steady and…
Q: Which enzyme adds the adenines to the 3' end of the pre-mRNA RNA Polymerase Poly(A) nuclease Poly(A)…
A: The process of addition of a poly (A) tail to the 3' end of the mRNA during its maturation is called…
Q: Glucose is a polar molecule. Would you predict that the amino acids of the enzyme hexokinase in the…
A: hexokinase catalyzes the transfer of the phosporyl group. The enzyme undergoes induced-fit…
Q: Describe the properties of water that are critical to maintaining life Include a discussion of…
A: Water most important element on earth without that life on earth can not be possible , without water…
Q: Incubating 10µl of an LDH sample for 5 min in the presence of 60mM of lactate and 100mM NAD+…
A: Lactate Dehydrogenase (LDH) activity can be figured using a spectrophotometric assay. The reaction…
Q: Match the following descriptions with the correct lipid-based compounds:…
A: Lipids are a class of compounds that are insoluble in water and soluble in nonpolar solvents. Lipids…
Q: Describe why water is considered to be the most indispensable nutrient. Include a minimum of three…
A: A water molecule is made up of three atoms which include one oxygen and two hydrogen atoms. Most…
Q: Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes
A: Mutation : A mutation is defined as the changes in the nucleotide sequence. These results in…
Q: How many types of histone proteins are present in eukaryotic chromatin? 3
A: In the nucleus of eukaryotic cells, histones are highly basic proteins with a lot of lysine and…
Why is important to note the Kit / Lot number and expiration date for each kit or tests done from each ELISA kit?
Step by step
Solved in 2 steps
- What is an antigen? What is an antibody? Why does each test include a control line? What specimen would be collected for an antigen test? Why is it important to not touch the tip of the swab?What specimen would be collected for an antibody test? How many lines for a positive antigen test?How many lines for a negative antigen test? What do three lines show in an antibody test?What would you use for a positive control in any ELISA test? What would you use for a negative control?In a direct ELISA, which of the following does the patient provide? A.) Substrate B.) Enzymes C.) Antibodies D.) Antigens
- The direct ELISA test requires only one antibody only one antigen both primary and secondary antibody only secondary antibody conjugated with enzyme systemWhy is a 1:20 dilution of patient serum, rather than undiluted patient serum, used for the qualitative test?why is it important for a clinical to understand false-positive and false-negative test results?