Answer the ff. questions: 1. What factors influence the metabolic rate of citrate in the mitochondria? 2. What is the fate of cytosolic pyruvate when it is reduced by cytosolic NADH? 3. Could leptin be used to treat obesity?

Q: Why is DNA not RNA the storage for genetic information?

A: DNA : Deoxyribonucleic acid is a genetic material for the storage of information. The structure of…

Q: Consider 41 NADH and 19 FADH, molecules funneling electrons into the electron transport chain…

A: Oxidative phosphorylation is the end point of energy-yielding metabolism in aerobic organisms. It…

Q: Prepare a concept map connecting carbohydrate and lipid synthesis. Your map should include shared…

A: Carbohydrate metabolism : Carbohydrates are the most abundant molecule defined as a poly hydroxy…

Q: Aldolase is a key enzyme in glycolysis that catalyzes the cleavage of its substrate,…

A: During glycolysis, Aldolase catalyzes the cleavage of its substrate fructose-1,6-bisphosphate into…

Q: Multiple forms of enzymes with the same catalytic activity but with different structures are called:…

A: Option (a) is incorrect because  Holoenzyme:- The complete, biologically active conjugated enzyme (…

Q: D. Lactate

A: Glycolysis is the phenomenon in which sequence of reactions converted glucose to pyruvate and…

Q: topic: gel electrophoresis What is the purpose of the running buffer?

A: The gel electrophoresis is a biochemical technique, which helps to separate the proteins and DNA,…

Q: For carbohydrates to be converted to energy, it undergoes the process of metabolism, where in the…

A: Carbohydrates are major energy source of human beings. It is most important component of our diet .…

Q: What are the diseases a-ketoglutarate dehydrogenase deficiency, succinate dehydrogenase deficiency,…

A: ketoglutarate dehydrogenase:  This is the enzyme that catalyses the conversion of alpha keto…

Q: Morphine (give structure) and enkephelin (give structure) both are antagonists of the m opioid…

A: An antagonist is a particular drug that blocks opioids by attaching to the specific opioid receptors…

Q: Calculate the overall ΔG° (report up to two decimal places) for the net reaction (see attached…

A: Standard free energy change is the Gibb's free energy at 273k temperature and 1 atm pressure ∆G°=…

Q: According to the search results from question 7, which of the following lipids is (currently) only…

A: Human body contains many sialic acid containing gangliosides or glycosphingolipids such as GM1,…

Q: dehydrogenase, which converts pyruvate to lactate in the presence of NADH. The velocity of the…

A: Kcat is also known as catalytic constant or turnover number. It can be defined as the amount of…

Q: HomeExpert Q&AMy answers How is serine related to the activated methyl cycle?    Serine’s side chain…

A: Serine is a non-essential amino acid. It is a glucogenic amino acid. Serine undergoes deamination…

Q: Is proteus vulgaris positive or negative in lia test? Why?

A: Proteus vulgaris is a gram negative bacteria that test positive for indole and catalase production.…

Q: Which peptide will yield the following qualitative resul Millon's Test (+) Fohl's Test (+) Sakaguchi…

A: Introduction: Amino acids are the building block of proteins and are linked to a peptide bond. Each…

Q: Amino acids with non-polar side chains are zwitterions at a. middle pH levels, between the pKa’s of…

A: Amino acids are compounds with an amino group, a carboxyl group, a hydrogen atom, and a variable…

Q: Step by Step process of Embden-Meyerhof pathway of RBC metabolism     Pls Explain as simple as…

A:

Q: Why is understanding reaction rates significant? Indicate at least 3 key importance of understanding…

A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…

Q: Sample Observation Remarks Albumin A Casein B Glycine C Tyrosine D

A: Ninhydrin test: This is a specific test for the identification of Amino acids, ammonia, primary /…

Q: Write the metabolism (phase 1 & phase 2) of Phenoxybenzamin

A: Phenoxybenzamine is an alpha-adrenergic antagonist with long duration of action because of longer…

Q: The laboratory requests of the physician are Glycosylated Hemoglobin and  Serum Glucose for Mr. John…

A: Introduction: Glycosylated hemoglobin is a form of hemoglobin that is measured primarily to monitor…

Q: 1. In one (1) sentence point out a key structural similarity and difference in each of the following…

A: There are 4 Biomacromolecules . They are carbohydrates, proteins , lipids and nucleic acids. Each of…

Q: How many cycles of β oxidation are necessary to completely catabolize palmitic acid ( CH3(CH2)14COOH…

A: Introduction: Fats are important sources of energy for our body as 1g of fat gives 9kcal of energy.…

Q: In which of the following pairs Is the first eleme than the second? (1 Point) O 0, P O Cs, Rb O I,…

A: Electronegativity - It is property of an atom in a molecule. The tendency of an atom to attract the…

Q: a) Lock and key model versus induced fit model of enzyme activity. (b) Competitive and…

A: Introduction: All the biochemical reactions are enzymes catalyzed in a living organism. Enzymes are…

Q: Roam around your kitchen and collect some items that you can categorize as sources of each…

A: Carbohydrates are one of the important nutrient. Its major functions as a energy source, and also…

Q: Feedback See Periodic Table Which of the following correctly describe both a lectin and a…

A: Lectins are stated as either the proteins or the glycoproteins that are present in almost all…

Q: rue or False? a. Ribose and deoxyribose are formed from glucose.

A: Ribose is a pentose sugar with molecular formula C₅H₁₀O₅, it is the prime component of…

Q: Enzymes act by: a. increasing the activation energy for a reaction b. lowering the activation energy…

A: An enzyme has the ability to attract the substrate to the active site which further results in the…

Q: hat are the components of Water? Explain and show some illustration

A: Introduction: For the existence of all living things, water is very essential. Without water, one…

Q: hosphate buffers are commonly used to mimic biological systems. Given that phosophoric acid is a…

A: Phosphate Buffer System consists or made up of:- Sodium  Dihydrogen Phosphate & Disodium…

Q: Which of the following statements are TRUE? Multiple answers are accepted for this question a .Two…

A: Two answers are correct

Q: What is the difference between the two salt precipitation methods: salting in and salting out?…

A: The solubility of a protein in solution depends on the concentration of the salt present in…

Q: .  Label each statement about the polynucleotide ATGGCG as true or false. a) The polynucleotide…

A: Polynucleotides are found naturally in all living organisms and play a variety of roles in them. A…

Q: Which of the following is the polyadenylation signal sequence? AAAAAA O AAUAAA O AAAUAA AAUUAA

A: Polyadenylation signal sequence :- is the signal sequence needed to add poly A tail at 3' end of…

Q: The Human genome project used the following methods Shotgun Sanger Both None

A: The Human Genome Project : It was an international  effort to find the DNA sequence of the complete…

Q: What type of control generally involves binding of a repressor protein to a regulatory DNA sequence?…

A: Repressor : DNA binding protein which inhibits the expression of 1 or more genes via the binding to…

Q: 1. Calculate the overall AG°' (reported up to two decimal places) for the net reaction. kJ/mol 2.…

A: In biological systems, a thermodynamically unfavorable reaction with a positive Delta G value is…

Q: the 3 major pathways that eventually become entry points of molecules into the Krebs Cycle?  What…

A: TCA / Krebs cycle : An ingenious series of reaction catalyzes by eight different enzyme that…

Q: In the RBCs of the patient described in the picture, which of the following would be expected?…

A: Glycolysis occurs in both aerobic as well as anaerobic respiration. Glycolysis is the only…

Q: di-deoxy nucleotides terminate DNA elongation in Maxam-gilbert method. True False

A: First-generation DNA sequencing methods include Maxam–Gilbert sequencing and the Sanger method.…

Q: TRNA and 5S RNA genes both have the following internal control region. BoxA BoxB BoxC

A: An internal control region is determines as a sequence that is made up of DNA and is located only…

Q: (Q39) A mutation in a certain protein results in the presence of a cysteine residue (rather than the…

A: A mutation is considered as a change in a DNA sequence. Mutations can easily result from specific…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: Determine whether the following monosaccharides have D or L configuration and classify them based on…

A: In the d/l system (named after Latin dexter and laevus) molecules are named relating them to the…

Q: gel electrophoresis

A: Gel Electrophoresis is a simple , rapid and analytical technique which is used for separating the…

Q: Which among the following The colored solution formed as a positive result for the Biuret test is…

A: A polypeptide chain has amino acids linked together by a peptide backbone.

Q: Since pepsin is a gastric enzyme, does it have an acidic or alkaline optimum pH? • What happens to…

A: The gastric juice comprises of water, mucus, hydrochloric acid, pepsin, and intrinsic factor and…

Q: 12 If strong-base anion exchange resin is applied to treat raw water with silicate, the pH of raw…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…