
Database System Concepts
7th Edition
ISBN: 9780078022159
Author: Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
COMMENT THE EXPLANATION FOR EACH LINE OF CODE PLEASE!! Python.

Transcribed Image Text:Write a program to generate 10 random numbers from -100 to 100. Save the randomly generate
numbers in a list. Create a function to count how many odd numbers are in a list. Create a function
to count how many even numbers are in the list. Create a function to sum up all the even numbers in
the list as well.
Expert Solution

arrow_forward
Useful functions
To generate random numbers
import random module
and use function random.randint(lower_value,upper_value)
Trending nowThis is a popular solution!
Step by stepSolved in 4 steps with 2 images

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- SyntaxError: invalid syntax (<string>, line 56)arrow_forwardPlease give me the html code of this programarrow_forwardPython code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…arrow_forward
- Project Description: The goal of this project is to write a program that can read data from any publicly available IoT source device and display it clearly to the user. The program will need to be written in Python (or any other programming language of your choice) and will need to include the following features: 1. Data Reading: The program should be able to read data from any publicly available IoT source device, such as a camera or any other sensor. The type of device is up to you, but they should be able to provide a valid URL for the device. The program should read the data from the device at regular intervals and store it in a data structure. 2. Data Display: The program should display the data that it reads from the IoT source device in a clear and easy-to-read format. The display could be in the form of a text-based output or a graphical interface, depending on your preference. The display should include information about the source sensor, as well as the data that was read…arrow_forwardCan you use Python programming language to to this question? Thanksarrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON
- C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONDatabase Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education

Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education

Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON

Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON

C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON

Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning

Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education