Write a short note on replication of DNA.
Q: Create the complementary DNA strand: AGC-CGA-CCA-TTA Your answer
A: Complementary DNA It is DNA synthesized from a single stranded RNA template in a reaction catalyzed…
Q: “DNA polymerase plays a dual function during DNA replication” comment onstatement?
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: The enzyme responsible for adding new nucleotides to a growing DNA chain during DNA replication is…
A: DNA is the nucleic acid that stores genetic information.
Q: Compare and contrast DNA replication with gene expression/protein synthesis. Include three…
A: The gene expression is a biological process in which information from the gen is used for the…
Q: Using the picture below, match each letter (A-E) to 5' or 3' DNA polymerase molecule Parental DNA…
A: As the options are not visible, we are answering the question based on the general principle of DNA…
Q: Compare the process of Replication, Transcription, and Translation by describing the following…
A: In the molecular biology, the genetic information is encoded in the DNA. Central dogma consists of…
Q: DNA
A: Introduction :- DNA replication is the biological process in which two identical copies of a DNA…
Q: Can you help me to explain these dna model
A: DNA( Deoxyribonucleic acid) is a molecule that carries all the information from one generation to…
Q: What is the difference between DNA proofreading and DNA repair? In 3-4 sentence
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. DNA used as…
Q: Tabulate 2 differences between DNA replication, the process of transcription and translation
A: Answer. Replication Transcription DNA replication is a process that takes place inside the…
Q: Explain in details the conservative replication of DNA and the dispersive replication of DNA
A: DNA replication is a process that takes place in every biological cell. It involves coping and…
Q: Letter 'd' corresponds to 5' 5' 3' origin of replication. primer. O replication fork. O Okazaki…
A: The Central Dogma theory states that DNA makes RNA and RNA makes proteins. DNA replication is the…
Q: DNA replication involves a
A: DNA Replication: DNA is a self replicating material which carries the genetic information of the…
Q: Describe two similarities and one difference between RNA polymerase and DNA polymerase Your answer…
A: RNA and DNA polymerase III are used in synthesizing nucleic acids . DNA polymerase has proofreading…
Q: Define replication unit or replicon
A: DNA replication is the mechanism by which two similar DNA molecules are copied into a double…
Q: The _____________ strand is made continously.
A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…
Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…
A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…
Q: True or False: Polymerases open the DNA and create the replication bubble while helicases run…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around one…
Q: The replication forks are where DNA ____________ is actively taking place.
A: Replication forks are the sites where two important processes occur; DNA unwinding and DNA…
Q: DNA polymerase replicates DNA producing a _______ strand.
A: Answer: DNA polymerase replicates DNA producing a new complementary strand. Explanation: Duplication…
Q: Why are enzymes needed in the process of the DNA replication
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: TAG, TA, and TGA are stop codor
A: 4) The 5' cap is added to the first nucleotide in the transcript during transcription. The cap is a…
Q: The following statements are correct EXCEPT: A) Information in the DNA is transcribed int mRNA and…
A: DNA is a genetic material which is safely stored inside the nucleus of the cell . It is ladder like…
Q: Choose the combination of answers that most accurately completes the statement.Select a drug or…
A: Antiviral medicines are a type of treatment for viral infections. A broad-spectrum antiviral is…
Q: What is the difference between prokaryotic and eukaryotic DNA replication? in 3-4 sentence
A: Genetic information present in double stranded DNA molecule is transmitted from one cell to another…
Q: Complete the complementary strand: DNA replication ATTCGAGGCTAA
A: DNA (deoxyribonucleic acid) replication is the fundamental process occurring in the cell by which…
Q: DNA replication diagram
A: DNA replicationDNA replication is processed by which DNA makes a copy of itself during cell…
Q: Explain about polymerase chain reaction
A: In the molecular and genetic analysis, to study the DNA sequence, a significant amount of DNA…
Q: Compare and contrast DNA replication with Protein Synthesis
A: The similarities are both Protein synthesis and DNA replication, DNA is involved. These both occurs…
Q: _____________ is responsible for adding new nucleotides to the DNA strand being created.
A: Two long polynucleotide chains made up of four diverse nucleotide sub units make up a DNA particle.…
Q: Adds nucleotides in the 5' to 3' direction during DNA replication.
A: The biological process of making two identical DNA copies from a single original DNA molecule is…
Q: DNA replication is bidirectional and discontinuous
A: DNA replication is a DNA dependent DNA synthetic process. DNA acts as the genetic material in the…
Q: The type of DNA replication error illustrated in the diagram below is _______________________
A: Frameshift mutation .
Q: Briefly explain bacterial DNA replication including the names of the enzymes involved in each stage…
A: Introduction :- During cell division, DNA replication is the process by which DNA duplicates itself.…
Q: Write a short note on replication of DNA.
A: Cells are the most fundamental and essential unit of life in all living things. All of life's…
Q: tabulate 2 differences between DNA replication, the process of trancsription and translation…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Replicate the DNA strand AAGGCTAACGGCATTTAACCC. Transcribe the DNA strand AAGGCTAACGGCATTTAACCC.…
A: In most organisms, genetic material is stored in the form of DNA. In humans, each cell's nucleus has…
Q: Define the term DNA.
A: Gregor Mendel: Father of genetics Genetic material are the substance which are responsible for the…
Q: What enzymes are required for the initiation of replication in eukaryotes? Are these complexes the…
A: DNA replication in eukaryotes takes place in three stages: initiation, elongation, and termination,…
Q: Examine the diagram carefully, and then answer the question below. vii VII i V iv vii Which one of…
A: Q. Which one of the following gives the correct names for the protein above ? Answer - (C) Helicase…
Q: Determine the enzymes present in DNA replication for the process to proceed normally.
A: Determine the enzymes present in DNA replication for the process to proceed normally.
Q: missing word to complete the diagram. Replication Translation Proteins Transcription RNA DNA
A: It describes the normal flow of biological information: DNA can be copied to DNA ( DNA replication)…
Q: Identify if the statement is correct or incorrect, "DNA synthesis begins at specific nucleotide…
A: DNA replication is the process by which DNA generates a copy of itself during cell division using a…
Q: Compare the process of Replication, Transcription, and Translation by describing the following…
A: DNA is genetic material in most of the organism . It carries genetic information which is required…
Q: DNA polymerase
A: For DNA to under replication it requires different proteins and enzymes. They are, DNA polymerases,…
Q: Agree or Disagree. Read the statement carefully & write your answer on the space provided.…
A: Introduction: Deoxyribonucleic acid or DNA is a type of nucleic acid that is present in the nucleus…
Q: The steps that involve complementary base pairing is the second step in which the nucleotide is…
A: 1. DNA replication is the process by which two identical copies of the DNA template strand is…
Q: Explain steps in DNA replication with words and pictures
A: DNA replication occurs in the cytoplasm of prokaryotes and in the nucleus of eukaryotes. DNA…
Q: Which of the following statements indicates the correct model and provides the appropriate…
A: DNA is the genetic material of almost all living organisms. It contains information that is passed…
Q: Describe the three results of the lack of success of DNA repair. What are the consequences of each?…
A: DNA repair disorders are caused by genes that are involved in DNA mutation detection, repair, etc.…
Step by step
Solved in 2 steps with 4 images
- Draw and label a diagram showing four DNA nucleotides, linked together in two strands. PLEASE DRAW ON PAPERView the given linked video to see the detailed structure of the different kinds of DNA. After analyzing make a simple illustration to relate the different kinds of DNA to its function. https://www.youtube.com/watch?v=o_-6JXLYS-kEcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
