Write the 3' to 5' DNA bottom strand • Write the mRNA sequence of top strand Write the mRNA sequence of bottom strand • Write the Protein sequence of the Bottom strand Which enzyme should be used to differentiate (detect the mutation) in sequence 2 1) cac agt aca tca gac atg gat cca agc cca tgt ata ccc ccg aac 2) cac agt aca tca gac atg gtT cca agc cca tgt ata ccc ccg aac 3) cac agt aca tca gac atg gaC cca agc cca tgt ata ccc ccg aac

Write the 3' to 5' DNA bottom strand • Write the mRNA sequence of top strand Write the mRNA sequence of bottom strand • Write the Protein sequence of the Bottom strand Which enzyme should be used to differentiate (detect the mutation) in sequence 2 1) cac agt aca tca gac atg gat cca agc cca tgt ata ccc ccg aac 2) cac agt aca tca gac atg gtT cca agc cca tgt ata ccc ccg aac 3) cac agt aca tca gac atg gaC cca agc cca tgt ata ccc ccg aac

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 7QP: Cloning Genes Is a Multistep Process The following DNA sequence contains a six-base sequence that is...

See similar textbooks

Similar questions

Cloning Genes Is a Multistep Process The following DNA sequence contains a six-base sequence that is a recognition and cutting site for a restriction enzyme. What is this sequence? Which enzyme will cut this sequence? (See Figure 13.5 for help.) 5 CCGAGGAAGCTTAC 3 3 GGCTCCTTCGAATG 5
A cloned fragment of DNA was sequenced by using thedideoxy chain-termination method. A part of the autoradiogram of the sequencing gel is represented here.ddA ddG ddT ddCa. Deduce the nucleotide sequence of the DNAnucleotide chain synthesized from the primer. Label the5′ and 3′ ends.b. Deduce the nucleotide sequence of the DNAnucleotide chain used as the template strand. Label the5′ and 3′ ends.c. Write out the nucleotide sequence of the DNA doublehelix (label the 5′ and 3′ ends)
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above
When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises.(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction digest (include those sequences remaining from the EcoRI recognition sequence).(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and the four deoxynucleoside triphosphates.(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in (b) are ligated (d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that degrades only single-stranded DNA.(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (d).(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction digest (include those sequences remaining from the PvuII recognition…
What is the dna strand sequence for phosphate sugar backbone? What are sticky ends in restriction enzymes can you examples to help me understand. Does where you cleave affect the length of the sticky ends overhang? 5-3directionalytgg atc gat atc gcc aat.
On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide victims that are being identified, while sample D came from a hair sample brought by a mother looking for the remains of her son. (see img) i. If similar band patterns in a gel are created using the same restriction enzyme, what does that tell you about the DNA sequence of the samples? ii. In sample C, only two fragments were created. How many restriction sites (regions where enzymes cut) are present in sample C?
An E. coli genomic DNA fragment is run out on a gel undigested (U), and then with two different restriction enzymes. Based on the gel below, what is the most appropriate reason for the and pattern displayed? DpnI is likely a restriction enzyme naturally found in E. coli. The DNA fragment is methylated at the EcoRI cut site, but not the DpnI cut site. EcoRI targets methylated cut sites. There is no DpnI cut site on the DNA fragment. The DNA is methylated at the DpnI cut site, but not the EcoRI cut site.
A 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6 kb. When the 10 kb fragment is digested with BamHI, three fragments of 1, 3.5 and 5.5 kb are generated. Digestion with both enzymes yields four fragments of 0.5, 1, 3 and 5.5 kb. Draw the restriction map for the 10 kb fragment based on the data. Label the cut sites for the two enzymes, and the lengths between the cut sites.
Above are the results of gel electrophoresis following digestion with restriction enzymes. What is the total length of the DNA fragment? Which enzyme, HindIII or EcoRI, produced a larger fragment? What part of DNA causes it to be negatively charged in order for electrophoresis to work?
Which of the following best describes the process of DNA seqencing. a. DNA is seperated on a gel and the different bands are labled with flouroscent nucleotides and scanned with a laser. b. A laser is used to flurorescently label the nucleotides present with in the DNA , the DNA is run on a gel and then the DNA is droken into fragments c. Nucleotides are scanned with a laser and incrprorated into the DNA that has been seperated on a gel and then DNA is amplified with PCR. d. fragments of DNA are produced in a reaction that lables them with any of four different fluroscent dyes and the fragmented then are run on a gel and scanned with laser e. DNA is broken down into its constituents nucleotides and the nucleotides are then run on a gel and purified with a laser
The sequences below indicated the 6bp recognition site for the restriction enzyme EcoRI. The lines indicate the sites where the enzyme will cut each strand. 1). write the sequence and structure of the two DNA pieces after the enzyme cuts (hydrogen bonds holding the strands together between the lines are broken after enzyme cuts) 2). indicate whether EcoRI generates blunt or sticky overhangs 5'- G I A A T T C - 3' 3' - C T T A A l G - 5'
Which of the following is a sequence most likely to be recognized by restriction enzymes? a. 5' GATTAATC 3' - double-strand form b. 5' ATG 3' - double-strand form c. 5' AUGCGCAU 3' - double-strand form d. NH3-met-trp-val- COOH e. none of the above