A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the nucleotide sequence in the complementary DNA strand and then (b) the sequence transcribed from the template strand in mRNA DNA information strand: 5’ AAC GTT CAA ACT GTC 3’

A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the nucleotide sequence in the complementary DNA strand and then (b) the sequence transcribed from the template strand in mRNA DNA information strand: 5’ AAC GTT CAA ACT GTC 3’

Name: A nucleotide sequence in a segment of a DNA information strand is give
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the nucleotide sequence in the complementary DNA strand and then (b) the sequence transcribed from the template strand in mRNADNA information strand: 5’ AAC GTT

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Figure 29.15 highlights in red the DNA phosphate oxygen atoms. Some of them interact with catabolite activator protein (CAP). What kind of interactions do you suppose predominate, and what kinds of CAP amino acid side chains might be involved in these interactions?
The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?
a) One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What nitrogenous bases would be found on "the other DNA strand lying alongside of it?" b) Which nitrogenous bases would be found on the MRNA (Messenger RNA) transcribed from a DNA strand with the following nucleotide sequence: AAA/TTT/GGG/CCC?
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5' TEMPLATE STRAND 5' TAGCCAATTG 3' CODING STRAND 1. 5' AUCGGUUAAC 3' 2. 3' GUUAAGGCAU 5' 3. 3' GUUAACCGAU 5’ 4. 5' UAGCCUUAAC 3'
Give the mRNA nad amino acid sequence from the given DNA strand.3' G G A T T A T C G G A T T G C C G T A G 5'5' C C T A A T A G C C T A A C G G C A T C 3'
If the mRNA sequence is 5'-UUU-CCC-AAA-3'.The DNA coding strand should be 5'-TTT-CCC-AAA-3' ?The DNA template strand should be 3'-AAA-GGG-TTT-5' ?So in the 5 to 3 direction, the DNA template strand should be 5'TTT-GGG-AAA-3' ?
Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCU
What is the sequence of the DNA template strand from which each of the following mRNA strands was synthesized? a. 5 '–UGGGGCAUU–3 ' c. 5 '–CCGACGAUG–3 'b. 5 '–GUACCU–3 ' d. 5 '–GUAGUCACG–3 '