Write the basic concepts in metabolism
Q: If glycogen is depleted in the liver, which of the following is also occurring? Group of answer…
A: This phenomenon is stated as "hitting the wall". Glycogen depletion may be forestalled in 3 viable…
Q: Failure of anti-oxidant function results in the hydroxylation of an aromatic acid of Enzyme Z and…
A: It isn't mentioned in the question on which strand of the c-DNA was taken for Sanger sequencing. So…
Q: a. State TWO (2) advantages of Inductively coupled plasma-optical emission spectroscopy (ICP-OES)…
A: Advantages of Inductively coupled plasma-optical emission spectroscopy over flame atomic absorption…
Q: The hydrolysis of the phosphoester bond of ATP releases a large amount of free energy. True or…
A: Question: The hydrolysis of the phosphoester bond of ATP releases a large amount of free energy…
Q: On average, 180 liters of plasma are filtered each day. A If humans had to expend one molecule of…
A: An important "energy molecule" found in every living organism, adenosine 5′-triphosphate is…
Q: Gel Filtration Chromatography Affinity Chromatography SDS-PAGE
A: The branch of biology completely focuses on studying the various biological life processes at…
Q: Qualitative and Quantitative Tests for Amino Acids and Proteins Complete the table: Test Reagents…
A: Introduction: Amino acids are biomolecules containing an amino and a carboxyl group with a side…
Q: For an enzymatic reaction, the following data were obtained for two different initial enzyme…
A: Enzymes are protein molecules that increase the rate of reactions by decreasing the activation…
Q: To establish a standard curve for a BSA standard curve using Bradford, the spectrophotometer…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These…
Q: Which of the following steps does NOT require ATP? O A. Conversion of glucose to glucose 6-phosphate…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: The reason for the increase in the rate of an enzyme reaction when the temperature is increased is…
A: The increase in the rate of Enzyme reaction is due to the increase in kinetic energy and the…
Q: Write the reactions of the TCA cycle, naming all enzymes and providing the structural formulas of…
A: TCA cycle ( tricarboxylic acid cycle) is also known as citric acid cycle or Krebs cycle. It occurs…
Q: explain Role of telomere in disease give a diagram
A: A telomere is a region at the ends of linear chromosomes that contains repeating nucleotide…
Q: How many ATP and NADH molecules would be produced during the citric acid cycle if 3 molecules of…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: Ön average, 180 liters of plasma are filtered each day. A If humans had to expend one molecule of…
A: Introduction: A mole of any substance contains as many elementary units (atoms and molecules) as the…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: malate dehydrogenase is interconverted into isozymic forms by oxidizing and reducing agents
A: Malate dehydrogenase is found in a variety of organs in vertebrates. It has been discovered that…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5 -TGTCCCA-3'…
A: Nucleic acids are the biomolecules composed of nucleotide units. A nucleotide unit is composed of a…
Q: Neurotransmitters of inhibitory signal makes the membrane potential more positive. Select one: O…
A: Hi, thank you for posting the question on Bartleby. As per the guidelines, we are authorized to…
Q: Give the functions of both water-soluble and fat-soluble vitamins
A: The B vitamins (folate, thiamine, riboflavin, niacin, pantothenic acid, biotin, vitamin B6, and…
Q: Calculate the protein concentration (in mg/ml) of an unknown sample with an absorbancy value of…
A: Bradford method of protein estimation is quick and simple method of protein estimation using…
Q: 1. (a) The reaction catalyzed by citrate synthase is the first step of the TCA cycle. In glycolysis,…
A: The highly exergonic (energy releasing) reaction catalyzed by citrate synthase is given below
Q: Hydrophobic signals after binding to the cell-surface receptors activate downstream signal…
A: Introduction: Cells do not work independently but continuously communicate with each other by…
Q: Which of the following cell types can do glycolysis, anaerobic respiration, glycogen biosynthesis,…
A: Gluconeogenesis is a process that converts non-carbohydrate substrates into glucose.
Q: Which of the following is incorrect concerning protein structure determination by X-ray…
A: Protein structure determination by X-Ray Crystallography: is a technique used to obtain the 3D…
Q: 3. Recombinant protein is produced by a genetically engineered strain of Escherichia coli during…
A: Disulfide-bonded proteins primarily mature in the oxidative environment of the eukaryotic…
Q: How do erythrocytes produce ATP? What is the role of ATP to red-cell morphology and function? 2. How…
A: Adenosine triphosphate (ATP) is an energy-carrying molecule particularly found in the cells of all…
Q: Which statements are associated with positively cooperative oxygen binding of a protein? A. The…
A: Haemoglobin is a tetrameric protein. It is a heterotetramer consisting of two alpha subunits and two…
Q: Monosaccharides can be obtained not only from dietary carbohydrates but other major sources include…
A: Monosaccharides is a one of the type of carbohydrate. Monosaccharides are also called as simple…
Q: How can studying Proteins and amino acids answer the question "what is life?"?
A: We say that a Cell is a basic structural and functional unit of life. This cell is made up of…
Q: _____ 1. is the classification of enzyme where carbonic anhydrase belong ______ 2. is the name of…
A: The reaction catalyzed by carbonic anhydrase is given below. H2O + CO2⇌ H2CO3 ⇌ HCO3- + H+. The…
Q: 3. In the electron transport chain, electrons are transferred to enzyme complexes. Name the…
A: The electron transport chain occurs in mitochondria. ETC is a pathway in which the reducing…
Q: Consider a protein that is composed of two different polypeptide chains held together by several…
A: Proteins are composed of a linear chain of amino acids attached together via peptide bonds. Twenty…
Q: In Zak-Henley's method in Determination of Total Serum Cholesterol, determine role of the sulfuric…
A: Cholesterol is a type of steroid. The normal serum cholesterol is 125-200mg/dL. Elevated serum…
Q: Polyunsaturated fatty acids a). are solid at room temperature b). have carbon-carbon double bonds…
A: Fatty acids are carboxylic acids with long hydrocarbon chain. There are two types of fatty acids -…
Q: Pathologic and Non-pathologic causes of Urine Turbidity.
A: A turbid urine is defined as an unclear and cloudy urine when viewed directly. There can be various…
Q: Some enzymes require additional ...........................to catalyze reactions effectively. These…
A: Introduction: Enzymes are large biological molecules important for thousands of metabolic processes…
Q: In a different instance of two infants suspected to have a defi- ciency of the PDH complex because…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: what are the structural features of protein
A: Protein is most important macromolecule and biomolecule. It is building block of body and providing…
Q: explains the absorption of the GLEEVEC detailed
A: Introduction: Gleevec also known as imatinib mesylate is a kinase inhibitor that inhibits protein…
Q: What does NOT describe a starch?
A: Starch is a polysaccharide that is produced by most of green plants for the purpose of storage of…
Q: what are the dietary fats, and what are the dietary fat food and calorie densed beverage that lead…
A: Fats are made up of glycerol and fatty acids. Fats are classified into two types, saturated and…
Q: A) Describe the glycosidic bond (using standard convention) indicated by “Arrow a.” B) Draw the…
A: Sterols are lipids containing a steroid nucleus and an alkyl chain. The steroid nucleus is a 4 ring…
Q: Each of the following enzymes are similar in that they are all regulation points for the…
A: Enzymes are chemical substances that function in several biochemical reactions and help in the…
Q: Given the following results from qualitative tests performed on a sample, answer the succeeding…
A: Molisch's Test : This is the common biochemical test that performed to determine the presence of…
Q: Based on the knowiedge you gained from the cloning module, which of the lanes in th firure is…
A: PCR stands for a polymerase chain reaction. It helped in the lab to make millions of copies of a…
Q: alse about aminoglycosides Can be used in the treatment of tuberculosis O a. O b. They have activity…
A: Antibiotics known as aminoglycosides treat many serious infections caused by gram-negative…
Q: How consuming too much dietary fat and drinking carbonated drinks affects lipid metabolism
A: Dietary fat and carbonated drink consumption have been found to be associated with several different…
Q: 1. Label the "C" monosaccharide 2. Draw the open chain Fischer projection formula of the…
A: In the given molecule the different sugars are attached with the help of glycosidic bonds.
Q: i need the answer quickly
A: The metabolism of carbohydrates, fats and proteins takes place inside the adipocytes. The…
Step by step
Solved in 2 steps
- The preferred energy sources for the body are ________.Basal metabolic rate is a measure of ______. a. the total amount of calories you burn in 24 hours b. the amount of food energy needed to sustain basic body operations c. the amount of energy burned by skeletal muscle in a given period d. both a and bDescribe general categories of Metabolism.
