Each of the following enzymes are similar in that they are all regulation points for the pathway/cycle they operate in ... except for one enzyme. Which of the following is not a regulated enzyme? CPyruvate carboxylase Transketolase C Glycogen phosphorylase C Citrate Synthase Phosphofructokinase Acetyl CoA carboxylase
Q: Alcohol dehydrogenase is the enzyme that converts alcohols to aldehydes or ketones. Explain how…
A: Alcohol dehydrogenase is the enzyme that converts alcohol into an aldehyde. It is the enzyme that…
Q: Problem 2. Competitive inhibitors are commonly used to make pharmaceuticals. Some cancer drugs act…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: A 44-year-old man diagnosed with acute tubular necrosis has a blood urea nitrogen of 60 mg/dL and a…
A: A heart attack or a heart stroke can cause the tubular necrosis. This is a condition in which the…
Q: If a cell sample is placed in pure water, what is the concentration of the salt inside the cell?…
A: The water move inside the cell and outside the cell through the process of osmosis. If a cell is put…
Q: . This cell is dependent solely on glucose as an energy source a.Muscle cells b.Kidney cells…
A: 1. the cell that solely dependent on glucose source is- Answer- d. brain cells Glucose in human…
Q: explain why is the importance of pharmacogenetics in the world of forensic sceicn
A: Introduction: Pharmacogenetics is the study of how genetic differences in a single gene develop…
Q: Regarding cellular metabolism, mark the true statements: (a). Electrons from the oxidation of…
A: In cellular metabolism, complex sequences of controlled biochemical activities, often known as…
Q: Which of the following is incorrect concerning protein structure determination by X-ray…
A: Protein structure determination by X-Ray Crystallography: is a technique used to obtain the 3D…
Q: Sugar is an organic molecule. Most organic molecules are non-polar compounds making them insoluble…
A: A polar molecule is a molecule containing polar bonds having non-zero dipole moments.
Q: Which of the following is a product of the first stage of the pentose phosphate pathway?
A: Pentose phosphate pathway is a metabolic pathway that channelizes glucose in its glucose-6-phosphate…
Q: Usually found in prokaryotes, regulatory sequences lying adjacent to the DNA being transcribed are…
A: Usually found in prokaryotes, regulatory sequences lying adjacent to the DNA being transcribed are…
Q: 1. A student, halfan hourafter the dinner, containing about 150 g of carbohydrates, 20 g of fat, and…
A: Fats are glycerides (mono, di and tri), sterols, phospholipids and free fatty acids. it is stored in…
Q: Which of the two carbon sources, glucose or acetate, is more advantageous for the cultivation of…
A: E.coli - Escherichia coli, it requires a carbon source to grow to serve as substrate for the…
Q: Complete the following chart about PDHK activity by determining if the molecule would be in high or…
A: Pyruvate dehydrogenase kinase stands for (PDHK). This PDHK belongs to the kinase enzyme family.PDHK…
Q: How is it possible to maximize ethanol production using genetically modified yeasts?
A: A novel genetic engineering technique was used to make yeast more resistant to the negative effects…
Q: How does the DNA hold information?
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: Hydrophobic signals after binding to the cell-surface receptors activate downstream signal…
A: Introduction: Cells do not work independently but continuously communicate with each other by…
Q: Identify the monosaccharide below
A: Carbohydrates are largely composed of carbon and water, and most of them have the empirical formula…
Q: As the strands are synthesized in replication, which of the following is true?
A: The process of in which DNA molecule produce exact copy or replica of itself is known as the…
Q: For questions #23 - #27 A solution is made by dissolving 6.26g NAOH in 25.2g water. 19. What is the…
A: The number of moles of any compound is found by making use of formula: number of moles=given…
Q: Search and explain the Watson and Crick model of DNA.
A: Watson and Crick first described the structure of the DNA double helix using X-ray diffraction data…
Q: Which of the following enzyme is responsible for the regulation of biological nitrogen fixation? A.…
A: Nitrogen fixation is biochemical process by which molecular form of nitrogen with triple covalent…
Q: A researcher is trying to identify regulatory DNA sequences near a gene of interes- Several modified…
A: An enhancer is a a short region of DNA that when present either upstream or downstream of a gene can…
Q: In addition to cleaving peplides, chymotrypsin can akso catalyze the hydrołysis of certain small…
A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…
Q: Complete table 2. * Since you were not able to conduct an actual experiment on these tests, kindly…
A: Bromine test is a qualitative analysis of organic chemistry to detect unsaturation, anilines and…
Q: Categorize the electron carrier by the number of hydrogens that it can transfer in a single…
A: In the process of electron transport, one or more molecules accept electrons from another and donate…
Q: Given the knowledge of biochemistry, make a sample outline of a new 24-hour healthy meal. Provide…
A: The human body can be viewed as an engine that releases the energy contained in the foods it…
Q: What is the effect of a defective a(1→ 4) phosphatase in Pompe's disease (GSD II)? O Accumulation of…
A: Glycogen Storage Disease type II , also called Pompe's disease occurs to due to the deficiency of…
Q: The apo form of an enzyme: (select all that applies) Group of answer choices Is the cofactor-free…
A: Enzymes are biological catalysts that help living organisms speed up chemical reactions. Enzymes can…
Q: What functions would you expect to be served by residues such as (a) phenylalanine at the protein…
A: phenylalanine and aspartic acid are two of 20 amino acids involved in peptide bond formation in…
Q: ACTIVITY 6.2.4 Give the systematic name of the following cyclic monosaccharides: 1. Name: OH Н OH Н…
A: Monosaccharides are carbohydrates with single sugar unit. The structure of monosaccharides can be…
Q: ______ 1. is the name of the enzyme that catalyzes the hydration of carbon dioxide to bicarbonate…
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. The CO2 formed in the…
Q: Determine the effect (either no effect, increase, or decrease) of the following: a. What is the…
A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…
Q: In a study, an undergraduate student discovered a new enzyme involved in the metabolism of…
A: Enzymes are usually protein molecules which catalyzes several biochemical reactions. It works as a…
Q: The reason for the increase in the rate of an enzyme reaction when the temperature is increased is…
A: The increase in the rate of Enzyme reaction is due to the increase in kinetic energy and the…
Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT: A. GC Box B. GRE C. Pribnow…
A: The metallotheonein are cysteine rich low molecular weight metalloproteins that bind heavy metals…
Q: 2. Cells often use the same enzyme reaction pattern for analogous metabolic conversions. For…
A: A metabolic pathway is defined as a group of actions along with the interactions that lies between…
Q: Below is the structure of the _______ disaccharide ? The disaccharide below is a non-reducing…
A: Disaccharides which is also called biose or double sugar which is formed joining two monosaccharides…
Q: What is pH
A: It measures how acidic or alkaline the given solution is. It is very important to maintain the…
Q: Q1. Many of the components for lipid synthesis need to be "activated", which happens by a variety of…
A: Lipids are non-polar biomolecules, which act as the major components of the plasma membrane, energy…
Q: Which of the following components are found in lipoproteins? Choose all that apply a. DNA b.…
A: Lipoproteins are essential components of the body that transport nutrients around. Lipoproteins are…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: D-galactose from B-D-glucose can be differentiated using which method of analysis?
A: Glucose and galactose are carbohydrates. Galactose and glucose are examples of monosaccharides.…
Q: The Problem The three diseases in this study are borne out of errors that involve certain…
A: Introduction: Fumarase deficiency is a rare autosomal recessive metabolic disorder characterized by…
Q: Lane M 1 2 3 4 5 Content DNA ladder Replicate 1 Replicate 2 Replicate 3 Negative control Positive…
A: PCR stands for polymerase chain reaction. PCR is used to amplify nucleic acid segments for further…
Q: Which of the following monosaccharaides is a Hexose? Dihydroxyacetone phosphate (DHAP) Erythrose…
A:
Q: E. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long?…
A: The genetic code is a sequence of three-letter combinations of nucleotides called codons, each…
Q: How do you compare and contrast the structures between protein and carbohydrates?
A: Biomolecules are carbon-based organic compounds. Biomolecules are primarily made up of carbon,…
Q: 30. assicuatuib if 2alpha and 2 beta chains to form adult hemoglobin
A: HbA2 is a gene that in encodes for the alpha globin chain of haemoglobin in humans.
Q: Question 11 Match the different carbohydrates' nomenclature/ glycan representation with their…
A: IUPAC-IUBMB, symbol nomenclature, LINUCS, and linear code are different nomenclatures used to name…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Which of the following is a negative regulator of the pyruvate dehydrogenase complex (PDC)? 1. acetyl CoA 2. ADP 3. pyruvate 4. citrateWhich of the following catalyzes a step that does NOT produce CO2? Group of answer choices alpha-ketoglutarate dehydrogenase complex malate dehydrogenase pyruvate dehydrogenase complex isocitrate dehydrogenase Citrate synthase is regulated by... Group of answer choices Concentrations of substrate and products Fructose-2,6-Bisphosphate Covalent modification Allosteric regulation by the levels of NADDHWhich of the following is NOT a component of the pyruvate dehydrogenase complex? a. dihydrolipoyl dehydrogenase b. dihydrolipoyl transacetylase c. pyruvate dehydrogenase d. dihydrolipoyl catalase
- Most defects in pyruvate dehydrogenase complex are due to mutations in ______, so supplements with ______ are given. E2 and TPP E1 and lipoamide E3 and NAD+ E2 and lipoamide E1 and TPPComplete the following description of the mechanism of the pyruvate dehydrogenase complex by using words provided. Not all words will be used. Each word will be used only one time. Three enzymes of the pyruvate dehydrogenase complex work together to catalyze the production of Acetyl CoA from Pyruvate. First, a 2-carbon unit composed of Carbons # ____ and ____ of Pyruvate are added to the co-enzyme ______ and whereas Carbon # ______ leaves as CO. The C-2 unit together with the co-enzyme is called ______ .The C-2 unit is then transferred to the 2nd co-enzyme ____, which is initially in it ___ state. The enzyme that catalyzes this step is ______.From here, the C-2 unit is transferred to form a _____ linkage with CoA-SH to generate_____In the last step of glycolysis, phosphoenolpyruvate (PEP) is converted to pyruvate and during this reaction ATP is synthesized. Based on the fact that ATP is synthesized, which of the following enzymes would most likely catalyze this reaction? a. enolase b. pyruvate kinase c. aldolase d. pyruvate isomerase e. pyruvate dehydrogenase
- Which of the following is NOT a metabolic fate of pyruvate? The pyruvate dehydrogenase complex catalyzes the oxidative decarboxylation of pyruvate to form acetyl-CoA. Pyruvate carboxylase catalyzes the carboxylation of pyruvate to form oxaloacetate. Pyruvate kinase catalyzes the formation of phosphoenolpyruvate from pyruvate. Lactate dehydrogenase catalyzes the formation of lactate from pyruvate.Complete the following description of the mechanism of the pyruvate dehydrogenase complex by using words provided. Not all words will be used. Each word will be used only one time. 5 Three enzymes of the pyruvate dehydrogenase complex work together to catalyze the production of Acetyl CoA from Pyruvate. First, a 2-carbon unit composed of Carbons # Pyruvate are added to the co-enzyme and whereas Carbon # of leaves as CO» The C-2 unit together with the co-enzyme is called transferred to the 2nd co-enzyme 11 12 The C-2 unit is then which is initially in its state. The enzyme that catalyzes this step is From here, the C-2 unit is transferred to form a linkage with CoA-SH to generate Acetyl COA Oxidized Hydroxyethyl TPP Phosphodiester Reduced Hydroxypropiony! TPP Lipoamide E-1 NADH 3 Dihydrolipoyl dehydrogenase Thioester 2 HydroxyacetyITPp Dihydropipoyl Transacetylase Type the words in the correct order separated by commas. Example: 1, 3, E-1, Thioester, Lipoamide ...Explain the advantage to the cell of each of the following regulatory actions: a. The pyruvate dehydrogenase complex (PDC) is inhibited by ATP.b. Isocitrate dehydrogenase is stimulated by ADP.c. Pyruvate carboxylase is stimulated by acetyl-CoA.d. Citrate synthase is inhibited by NADH.e. PDC is inhibited by fatty acids
- Which of the following glycolytic enzymes catalyzes the conversion of fructose-1,6-bisphosphate into the two product molecules dihydroxyacetone phosphate, and glyceraldehyde-3-phosphate? phosphoglycerate kinase pyruvate kinase malate dehydrogenase aldolase phosphofructokinaseBelow are some statements about the TCA Cycle. Which statement is true based on what we have learned in the class? Question 16 options: Oxaloacetate can be replenished from pyruvate carboxylation catalyzed by pyruvate carboxylase. The catabolism of proteins can only feed into the TCA cycle at one point, which is Acetyl-CoA. Acetyl-CoA has transporter proteins and can be transported directly from matrix to cytoplasm (for fatty acid synthesis). In TCA cycle, both Acetyl-CoA and Succinyl-CoA hydrolysis reactions are coupled with ATP/GTP synthesis.Which of the following is most likely to cause accumulation of acetyl CoA? Group of answer choices There is not enough oxaloacetate present to run the citric acid cycle Increase activity of pyruvate dehydrogenase kinase Increased fatty acid synthesis Increased citrate synthase activity When fluoroacetate (an analog of acetate) is added to the mitochondria, it causes build up of fluorocitrate. Which of the following is most likely to be true? Group of answer choices Fluoroacetate cannot be converted to fluoroacetyl CoA Fluoroacetyl CoA cannot be combined with oxaloacetate to enter the citric acid cycle Addition of fluoroacetate will cause an increase in isocitrate Aconitase cannot use fluorocitrate as a substrate