NUMBER 8 Not 7 c. GGUACGAUd. ATCGTACC7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?AUGGCCGAUAAGCUGGG AUAUa. Met- Arg - Gin-Asn- Asp - Pro - Metb. Met-Arg- Leu- Phe-Asp- Pro-Metc. Met-Ala - Asp- Lys-Leu - Gly- Tyrd. Met-Ala- Glu- Arg-Arg- Glu- SerYhich amino acid is considered to be hydrophilic?8a. Methionineb. Alaninec. Glycined. Threonine

Hydrophilic amino acids are those acids which are highly stable when present in water. They are…

Answered: Yhich amino acid is considered to be…

Science

Biochemistry

Yhich amino acid is considered to be hydrophilic? a. Methionine b. Alanine c. Glycine d. Threonine

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 10TYK: A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The...

See similar textbooks

Related questions

Q: Choose the combination of answers that most accurately completes the statement. The nitrogen bases…

A: The thread-like structure that consists of the genetic information of the organism, located within…

Q: The Vitamin required for the synthesis of nucleic acid is: A) Tocoferorl B) Folic acid C)…

A: Vitamins are the substance that our body needs to develop and function. Vitamin A,D,E,K and B are…

Q: Write down the reactions of serine and arginine amino acids with carboxyl and amino groups.

A: Amino acids are the monomers of the macromolecule, proteins. Twenty different amino acids are…

Q: What is the main function of bile salts? Draw the structure of bile salts.

A: Bile salts are the detergent molecules synthesized by the liver cell and stored in the gallbladder.…

Q: The language of nucleic acids in DNA and RNA (choose all that apply)

Q: Choose the combination of answers that most accurately completes the statement.The primary mode of…

A: The microbial control is of two types, chemical and physical. The use of chemicals in killing or…

Q: Which compound is inorganic

A: All the chemical compounds can be classified into an organic or inorganic compound. This…

Q: Write short answers. i. Why proteins lose their function upon change in their 3D structure?

A: Proteins are most abundant macromolecules that occurs in cells and parts of cells. They are…

Q: Which is not an essential amino acid? a. Tryptophan b. Threonine c. Histidine d. Cysteine

A: On the basis of nutritional requirement amino acids are divided into three groups:- 1) Non…

Q: Speculate on the properties of proteins and peptides if none of the common amino acids contained…

A: A protein is a complex substance that consists of amino acids residues joined by peptide bonds.

Q: what are the main types if nucleic acids

A: Nucleic acid was first discovered by Friedrich Miescher from the nuclei of the pus cells…

Q: 6. Which of the following statements concerning bile acids is incorrect? They are... a. Insoluble in…

A: Bile acids are steroid acids present in bile of mammals and vertebrates. These bile acids are…

Q: Use Seliwanoff's test to distinguish fructose and surcose. If not possible, provide a reason.

A: The Seliwanoffs test is a test that is used to distinguish between aldose and ketose sugar. Upon…

Q: Short Answer Questions Draw and name three different functional groups. Draw the basic structure of…

A: Biomolecules refer to carbon- based organic compound that are produced by a living organism. These…

Q: How are enzymes used in medicine?

A: Enzymes Enzymes are catalysts, which means they speed up chemical reactions. For thousands of years,…

Q: Explain how nucleotides joined into two chains from the strands of a DNA molecule

A: For all living creatures and even plants, DNA is essential. For the processes of inheritance,…

Q: The polysaccharide found in plant cell walls isa. glucose.b. starch.c. maltose.d. cellulose.

A: Biomolecules such as carbohydrates, lipids, proteins etc. are very essential for sustaining life.…

Q: In a tabular form enumerate the carbohydrates and its significance

A: Carbohydrates are the most abundant biomolecules in nature and it is the major source of energy in…

Q: What is the relationship between vitamin A and β carotene? (Hint: Look up the structures on the…

A: Beta-carotene is one of a group of red, orange and yellow pigments called carotenoids. Beta-carotene…

Q: Which is a disaccharide? O glucose O fructose O sucrose cellulose

A: Monosaccharides are the simplest carbohydrates; and are termed simple sugars. A disaccharide is the…

Q: classical method to check the quality of Nucleic Acid Product

A: It is most commonly used today to perform a quick assessment of the purity of nucleic acid samples.…

Q: Phospholipase responsible for the tissue damage after spider bite? a.A1 b.A2 c.D d.C

A: Phospholipase (PLA) is a lipolytic enzymes which cleaves the phospholipid substrates at specific…

Q: Which describes the basic structure of a fatty acid

A: Biomolecules are the biological molecules that are present inside the living organisms. These…

Q: Define the term Biomolecules b) name the biomolecules which contribute as fuels

A: Bioenergetics involves energy metabolism which is a quantitative study of energy transductions…

Q: Another name for a protein chain is polypeptide

A: Protein is an important macromolecule which have it's linear or primary, secondary, tertiary and…

Q: Does a flour dissolves in water

A: A solvent is a compound that dissolves a solution, leading to a solution. A solvent is typically a…

Q: what molecule is responsible for protein synthesis *

A: Proteins are polymers of amino acids, linked by amide/peptide bond with release of a water molecule.…

Q: Is beer is sugar

A: Yeast, grains, spices, and water are the main ingredients in beer. Despite the fact that sugar is…

Q: A few simple sugars attached together.

A: Question - A few simple sugars attached together.

Q: compare and contrast carbohydrates from lipids.

A: Introduction: Carbohydrates and lipids are macromolecules that are made up of carbon, hydrogen, and…

Q: DNA is a __________ which is made up of nucleotides

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Give reason why potato cubes when placed in water become firm and increase in size.

A: Osmosis is a process through which the movement of water takes place through a semi-permeable…

Q: Choose the combination of answers that most accurately completes the statement. A nucleotide…

A: Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA) are two main types of nucleic acid present in…

Q: Answer SIMPLE or CONJUGATED ENZYME. a. An enzyme that contains a carbohydrate portion b. An enzyme…

A: The enzymes which are made from proteins only are known as simple enzymes, for example - pepsin,…

Q: what molecule is responsible for protein synthesis

A: mRNA molecule is responsible for protein synthesis .After transcription mRNA molecule goes to…

Q: What is function of RNA and proteins.

A: Proteins are complex molecules. They play many crucial roles in the body metabolism. RNA…

Q: which is the name of the given monosaccharide? a. Aldotriose b.Ketotriose c. Ketotetrose d.…

A: Carbohydrates are important molecules for a living cell as it is the major source of energy.…

Q: explain how iodine reacts with starch to be useful as a test for identity

A: Starch is a form of carbohydrate that is present in plants. It generally consists of a mixture of…

Q: A physician orders a diet of 20 g of protein, 300 g of carbohydrate, and 80 g of fat. Calculate the…

A: Diet therapy has primary goals such as preventing nutritional deficiencies, maintaining normal blood…

Q: The covalent bond that joins amino acids together (once dehydration synthesis has occurred) is…

A: 9) option B) peptide bond The linking of two amino acids is accompanied by the loss of a molecule of…

Q: ademic) Hemoglobin is a protein that has a Structure. Answer:

A: Hemoglobin is a main oxygen carrying protein which is present in red blood cells

Q: Deduce the number of isomers of fructose

A: Two or more compounds which have same formula but different arrangement of atoms in the molecule and…

Q: Create a concept map employing the different chemical tests for the differentiation of the types of…

A: Carbohydrates are polyhydroxy alcohols which are derivatives of aldehydes and ketones which are…

Q: What is the name of the bond formed between adjacent amino acids in a protein? Question 34 options:…

A: Every amino acid is connected to another amino acid by a covalent bond, known as a peptide bond. At…

Q: identify an amino acid that contains a side chain that can form hydrogen bonds with water (complete…

A: Amino acids are the biomolecules that contains alpha-amino and alpha-carboxylic acid groups in its…

Q: Which statement accurately describes the differences between RNA and DNA? RNA always folds into a…

A: DNA or deoxyribonucleic acid is a long molecule that contains a unique genetic code. It is a…

Q: Design an experiment to show how you can use Benedict's solution to quantify the presence of a…

A: The application of scientific and technical principles to the processing of the material by agents…

Q: How monomers of protein differ from each other

A: Proteins are biomolecules and the body’s building blocks. They play significant roles in body…

Question

NUMBER 8 Not 7

c. GGUACGAU
d. ATCGTACC
7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?
AUGGCCGAUAAGCUGGG AUAU
a. Met- Arg - Gin-Asn- Asp - Pro - Met
b. Met-Arg- Leu- Phe-Asp- Pro-Met
c. Met-Ala - Asp- Lys-Leu - Gly- Tyr
d. Met-Ala- Glu- Arg-Arg- Glu- Ser
Yhich amino acid is considered to be hydrophilic?
8
a. Methionine
b. Alanine
c. Glycine
d. Threonine

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Translate the mRNA into a protein using the genetic code. (Amino acid chain.) AUG( met)-UUU( Phe)-GUA( Val) - CAU (his)-UUG(leu) -UGU(cys)- GGG(gly)- AGU(ser)- CAC (his) - CUG(leu) GUU(Val)- GAG (Glu)-GCG(ala)- UUG(Leu)- UAU(tyr)- UUG (leu)-GUU(Val)- UGU(cys)- GGC(gly)-GAG( Glu)-CGC(arg) - GGC(gly) - UUU(phe) - UUC(phe).
DNAT A C C G C T C C G C C G T C G A C A A T A C C A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
DNAT A C C G C C C C A T G A T G A A T A C C G G G A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA template strand. (Remember that mRNA has uracil instead of thymine.) Template Strand: CGATACAAA
C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?
A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid chain are given below: mRNA segment: GCC UAC AAU GCG Amino acid chain: Ala-Tyr-Asn-Ala Knowing that insertion mutations shift the triplets by one base, if an insertion mutation adds a U to the beginning of that mRNA segment, what will be the new triplet/codon grouping and the new amino acid chain? Group of answer choices a. U GCC UAC AAU GCG; Ala-Tyr-Asn-Ala b. UCC UAC AAU GCG; Ser-Leu-Gln-Cys c. UGC CUA CAA UGC G; Cys-Leu-Gln-Cys d. UGC CUA CAA UGC G; Ala-Tyr-Asn-Ala e. UGCC UAC AAU GCG; Cys-Tyr-Asn-Ala
Predict the sequence of amino acid coded by the mrna sequence 5’ GGA-GGC-ACA-UGG- GAA 3’
What potential polypeptides can be produced from the following mRNA sequence? There are more than one answer.. 5’ ...GGAGCUCGUUGUAUU... 3’ a. ser-ser-leu-tyr b. leu-cys-cys-ser-arg c. gly-ala-ser-trp-ile d. gly-ala-arg-cys-ile e. glu-leu-val-val f. You can't translate without a start codon. I know (d) is one of the answer but I'm stuck on how to find the rest. Please help.
A gene affecting the behavioral outlook of individuals was discovered in several humans who can overcome anxiety caused by life's problems. Part of the gene that į translated into protein has a sequence 3'-GGATCCCGAATGTAATGCGTGCTC AATGGTAGTACGGC-5'. 1. What is the complementary strand of the DNA? 2. What is the sequence of the MRNA product after translation? 3. What is the sequence of the peptide encoded by the portion of the gene? (Use one letter symbol of amino acids)