You discover a new bacteria and are interested in mapping its genome with respect to 10 genes.You are able to infer time-of-entry maps for four Hfr strains, which are pictured below. What is themap of the bacterial genome based on these Hfr experiments?Hfr1GaENeHfr2SqLixTfNeHfr3U IDGaHfr4DUSqO Sq - Lix - Tf - Ne -E- M- Ga - D -1-UO Sq - Tf - Lix -U -E-D- Ne -D -M- GaOD-1-U- Sq - Lix - Ga - E -M- Tf - NeOD- Ne - Ga -E- M - Sq - I-U- Tf - LixO Lix - Ga - E - Sq -1-U- M -D- Tf - Ne

The conjugation experiment data is given in the question. The genes are transferred to the recipient…

Answered: You discover a new bacteria and are…

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter17: Bacterial And Viral Genetics

Section: Chapter Questions

Problem 1ITD

See similar textbooks

Similar questions

In a transformation experiment, donor DNA was obtained from aprototroph bacterial strain (a+b+c+), and the recipient was a tripleauxotroph (a-b-c-). What general conclusions can you draw aboutthe linkage relationships among the three genes from the followingtransformant classes that were recovered? a+ b- c- 180 a- b+ c- 150 a+ b+ c- 210 a- b- c+ 179 a+ b- c+ 2 a- b+ c+ 1 a+ b+ c+ 3
In five Hfr strains, each of which was used to build a time-of-transfer map, the genes entered the recipient cells as follows: Strain 1: S L A C T F Strain 2: N P F T C A Strain 3: T F P N U Y Strain 4: S H Y U N P Strain 5: U N P F T C Which of the following represents a correct gene map of these results? N P F T S L A C H U Y S L A C T F P N H Y U C T F P N U Y H S L A T C A L S P N U Y H F U N P C A L S F T H Y
As mentioned in question 2 of More Genetic TIPS, origins oftransfer can be located in many different places on a bacterial chromosome,and their direction of transfer can be clockwise or counterclockwise.Let’s suppose a researcher conjugated six differentHfr strains that were thr + leu + tons str r azis lac + gal + pro + met +to an F − strain that was thr − leu − tonr str s azir lac − gal − pro −met −, and obtained the following results: Draw a map of the circular E. coli chromosome that shows thelocations and orientations of the origins of transfer in these six Hfrstrains.
A group of genetics students mix two auxotrophic strains of bacteria: one is leu+ trp+ his− met− and the other is leu− trp− his+ met+. After mixing the two strains, they plate the bacteria on minimal medium and observe a few prototrophic colonies (leu+ trp+ his+ met+). They assume that some gene transfer has taken place between the two strains. How can they determine whether the transfer of genes is due to conjugation, transduction, or transformation?
Austin Taylor and Edward Adelberg isolated some new strains of Hfr cells that they then used to map several genes in E. coli by using interrupted conjugation . In one experiment, they mixed cells of Hfr strain AB-312, which were xyl+ mtl+ mal+ met+ and sensitive to phage T6, with F− strain AB-531, which was xyl− mtl− mal− met− and resistant to phage T6. The cells were allowed to undergo conjugation. At regular intervals, the researchers removed a sample of cells and interrupted conjugation by killing the Hfr cells with phage T6. The F− cells, which were resistant to phage T6, survivedand were then tested for the presence of genes transferred from the Hfr strain. The results of this experiment are shown in the accompanying graph. On the basis of these data, give the order of the xyl, mtl, mal, and met genes on the bacterial chromosome and indicate the minimum distances between them.
Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’
When the interrupted mating technique was used with five different strains of Hfr bacteria, the following orders of gene entry and recombination were observed. On the basis of these data, draw a map of the bacterial chromosome. Do the data support the concept of circularity?Hfr Strain Order1 T C H R O2 H R O M B3 M O R H C4 M B A K T5 C T K A B
You mix two auxotrophic strains of bacteria; one is leu+ trp+ his– met– and the other is leu– trp– his+ met+. After mixing the two strains, you plate the bacteria on minimal medium and observe a few prototrophic colonies (leu+ trp+ his+ met+). To determine whether gene transfer has occurred through conjugation, transformation, or transduction, you design an experiment in which you place filters between the two strains to see if gene transfer occurs. You set up three treatments:-Treatment A No filter, allowing contact between the bacterial strains-Treatment B Filter that blocks cells, but allows viruses and DNA through the filter-Treatment C Filter that blocks cells and viruses, but allows DNA through the filter When you check the results of your experiment, you find prototrophic colonies have occurred following treatments A and B, but not following treatment C. You conclude that gene transfer occurred through... Answer Choices Available: A) Conjugation B) Transformation C)…
In Figure 10-10, determine approximately how manyBAC clones are needed to provide 1× coverage ofa. the yeast genome (12 Mbp).b. the E. coli genome (4.1 Mbp).c. the fruit-fly genome (130 Mbp).
Austin Taylor and Edward Adelberg isolated some new strains of Hfr cells that they then used to map several genes in Escherichia coli by using interrupted conjugation. In one experiment, the researchers mixed cells of Hfr strain AB‑312, which were xyl+ mtl+ mal+ met+ and sensitive to phage T6, with F− strain AB‑531, which was xyl− mtl− mal− met− and resistant to phage T6. The cells were allowed to undergo conjugation. At regular intervals, the researchers removed a sample of cells and interrupted conjugation by killing the Hfr cells with phage T6. The F− cells, which were resistant to phage T6, survived and were then tested for the presence of genes transferred from the Hfr strain. The results of this experiment are shown in the graph. On the basis of these data, give the order of the xyl, mtl, mal, and met genes on the bacterial chromosome and the minimum distances between them in minutes. The origin of transfer is represented by the red triangle. The distances between genes are not…
In E. coli, four Hfr strains donate the following markers,shown in the order donated:Strain 1: M Z X W CStrain 2: L A N C WStrain 3: A L B R UStrain 4: Z M U R BAll these Hfr strains are derived from the same F+ strain.What is the order of these markers on the circularchromosome of the original F+?
By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the order of many bacterialgenes. Throughout the course of their studies, they identified severaldifferent Hfr strains in which the F-factor DNA had been integratedat different places along the bacterial chromosome. A sample oftheir experimental results is shown in the following table: A. E xplain how these results are consistent with the idea that thebacterial chromosome is circular.B. Draw a map of the bacterial chromosome that shows the orderof genes and the locations of the origins of transfer among thesedifferent Hfr strains.

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS