You isolate a bunch of different mutants, all in the same gene, that effects body length in your model genetic organism. You have organized your observations in the table below. Wild type length Length of heterozygotes Length of homozygotes Mutant 1 2 cm 1.5 cm 1 cm Mutant 2 2 cm 1 cm 1 cm Mutant 3 2 cm 1.5 cm 1 cm Mutant 4 2 cm 2 cm 1 cm 1. Which of the above is a recessive mutation? 2. Which of the above is a Dominant mutation? 3. Mutants 1 and 3 have very similar results, but there are 2 types of dominate mutations that can cause this? What are they and how will you distinguish between them?

You isolate a bunch of different mutants, all in the same gene, that effects body length in your model genetic organism. You have organized your observations in the table below. Wild type length Length of heterozygotes Length of homozygotes Mutant 1 2 cm 1.5 cm 1 cm Mutant 2 2 cm 1 cm 1 cm Mutant 3 2 cm 1.5 cm 1 cm Mutant 4 2 cm 2 cm 1 cm 1. Which of the above is a recessive mutation? 2. Which of the above is a Dominant mutation? 3. Mutants 1 and 3 have very similar results, but there are 2 types of dominate mutations that can cause this? What are they and how will you distinguish between them?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 2QP: Achondroplasia is an autosomal dominant form of dwarfism caused by a single gene mutation. Calculate...

See similar textbooks

Similar questions

The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
In DNA-hybridization experiments on six species of plants in the genus Vicia, DNA was isolated from each of the six species, denatured by heating, and sheared into small fragments (W. Y. Chooi. 1971. Genetics 68:213–230). In one experiment, DNA from each species and from E. coli was allowed to renature. The graph shows the results of this renaturation experiment. Q. Notice that, for the Vicia species, the rate of renaturation is much faster in the first hour and then slows down. What might cause this initial rapid renaturation and the subsequent slowdown?
Null mutations are valuable genetic resources becausethey allow a researcher to determine what happens to anorganism in the complete absence of a particular protein. However, it is often not a trivial matter to determinewhether a mutation represents the null state of the gene.a. Geneticists sometimes use the following test forthe nullness of an allele in a diploid organism: If theabnormal phenotype seen in a homozygote for theallele is identical to that seen in a heterozygote(where one chromosome carries the allele in question and the homologous chromosome is known tobe completely deleted for the gene) then the alleleis null. What is the underlying rationale for thistest? What limitations might there be in interpreting such a result?b. Can you think of other methods to determinewhether an allele represents the null state of a particular gene?
. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?
In DNA-hybridization experiments on six species of plants in the genus Vicia, DNA was isolated from each of the six species, denatured by heating, and sheared into small fragments (W. Y. Chooi. 1971. Genetics 68:213–230). In one experiment, DNA from each species and from E. coli was allowed to renature. The graph shows the results of this renaturation experiment. Q. Can you explain why the E. coli DNA renatures at a much faster rate than does DNA from any of the Vicia species?
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Achondroplasia is an autosomal dominant form of dwarfism caused by a single gene mutation. Calculate the mutation rate of this gene given the following data: 10 achondroplastic births to unaffected parents in 245,000 births.
The results of a paternity test are shown in the table below. Numbers indicate the number of short tandem repeats for loci tested. Whos the daddy? How sure are you?
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
e. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and Brenner had recombined one + and one −mutation is shown here. (The RNA-like strand of theDNA is shown.)wild type 5′ AAA AGT CCA TCA CTT AAT GCC 3′mutant 5′ AAA GTC CAT CAC TTA ATG GCC 3′a. Where are the + and − mutations in the mutant DNA?b. The double mutant produces wild-type plaques.What alterations in amino acids occurred in thisdouble mutant?c. How can you explain the fact that amino acids aredifferent in the double mutant than in the wild-typesequence, yet the phage has a wild-type phenotype?
A method for detecting methylated CpGs involvesthe use of a chemical called bisulfite, which convertscytosine to uracil but leaves methylated cytosine untouched. You want to know whether a particularCpG dinucleotide at one location in the genome ismethylated on one or both strands in a tissue sample.The genomic sequence containing this CpG is:5’...TCCATCGCTGCA…3’. You take genomicDNA from the sample tissue, treat it exhaustivelywith bisulfite, and then use flanking primers toPCR-amplify the region including this CpGdinucleotide. You then want to Sanger sequence(see Fig. 9.7) the amplified PCR product. a. After you treat genomic DNA with bisulfite, the twoDNA strands will melt into single strands. Why?b. Your answer to part (a) introduces a potential complication, because if you do not account for this result of bisulfite treatment, the PCR primers willnot amplify the DNA. What special considerationswould be necessary when you design your PCRprimers for this experiment? Could one pair…
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′