Your supervisor asks you to carry out an in vitro transcription reaction. Unfortunately, they are called away from the lab before they can tell you which tube contains the polymerase enzyme. You look in the freezer and find four tubes with somewhat cryptic labels. Which tube would you use?
Q: proteins are deamidated in an aqueous solution to produce ammonium and aspartate, respectively, from...
A: Isoelectric focusing (IEF), also known as electrofocusing, is a technique for separating different m...
Q: Explain how the carbonate-bicarbonate buffer system works in balancing acid-base in the blood.
A: Buffers are solutions that have weak acid and its conjugate base. They nullify small changes in the...
Q: 2) Sugest I strategy frr golhers of A. b) write alown peptide sequence with bath 3 1. letted and c) ...
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl g...
Q: A) llustrate in molecular detail how hemoglobin's reduced oxygen affinity is caused by protonation o...
A: Hemoglobin (Hb) is a protein molecule which is present in red blood cells and carries oxygen from th...
Q: what molecule is responsible for protein synthesis *
A: Proteins are polymers of amino acids, linked by amide/peptide bond with release of a water molecule....
Q: I have four amino acids: serine, histidine, alanine, and tyrosine. How many different primary struct...
A: Proteins are composed of amino acids linked together by peptide linkages. T he primary structure of ...
Q: What are the advantages of the presence of organelles in eukaryotic cells?
A: The eukaryotic cell has several organelles and is compartmentalized.
Q: SDS-PAGE gels are useful in determining the molecular weights of proteins; however, the molecular we...
A: SDS-PAGE is an acronym for sodium dodecyl sulfate–polyacrylamide gel electrophoresis. It’s a mass-ba...
Q: Describe the composition of a salt and explain the ways in which salts are important in organisms.
A: Salt is an important constituent for the human and animals. Salt plays numerous important physiologi...
Q: is not formed during the Krebs cycle. * Lactate Critic acid O Oxaloacetate Isocitrate Succinate
A: Aerobic metabolism is a set of three basic metabolic processes that occur in cells to generate energ...
Q: 1. What is the chemical basis for a positive test in Barfoed's Test? 2. What is the chemical basis f...
A: The qualitative tests are used to detect the presence or absence of a substance. Different qualitati...
Q: What is the role of ATP in cell signaling in biochemistry?
A: ATP has key functions in cell signaling and the signal transduction process heavily relies on ATP. A...
Q: What advantage do alternative sigma factors have for bacterial gene expression?
A: Sigma factors are dissociable subunits of prokaryotic RNA polymerase that are required for its funct...
Q: The PH of a buffer solution should be at ... * Ka value PKa value O 7 14 7.4 ООО
A: A buffer solution is a solution that changes pH slightly on the addition of a small amount of strong...
Q: Some of the test(s) you tried from this virtual lab are important basis for determining glucose leve...
A: The sugar present in the blood or urine sample is glucose.
Q: 9. Shown below is a binding pocket for a protein with a ligand bound. The ligand interacts with a se...
A: For an equilibrium interaction between a Protein 'P' and Ligand 'L' forming a Protein-Ligand comple...
Q: You've isolated a novel protein, but you believe what you actually have is a mixture of the unmodifi...
A: Amino acids are biomolecules that are comprised of two functional groups, these are an amino group (...
Q: Why do you think DNA is the genetic material used by eukaryotes instead of RNA?
A: Deoxyribonucleic acid (DNA): Nucleic acids are molecules that store hereditary information for perf...
Q: Explain why all mono- and disaccharides are soluble in water? What are some examples of artificial s...
A: All mono- and disaccharides are soluble in water. Monosaccharides are glucose, fructose, and galacto...
Q: In a given sample (whole organism, tissue, cell, subcellular compartment), what fraction of the whol...
A: Biological processes require several different macromolecules for their metabolic and functional sup...
Q: The extracellular sodium [Na+]0 is reduced in the saline bath. Following another current injection ...
A: Polar large size molecules (glucose, amino acids) and Ions (Na+, H+,k+, Ca+) can't pass...
Q: The released energy obtained by oxidation of glucose in cell respiration is transient stored as . O ...
A: All biological reactions that take place in a cell are referred to as the metabolism. It is divided ...
Q: Draw out the predominant form of the polypeptide: WERLC at a pH of 9.
A: The process of translation takes place in the cytoplasm which converts mRNA to protein. nucleo...
Q: Explain the single nucleotide polymorphisms (SNPS) application in medical industries and analyze why...
A: SNP's are point mutations that change the identity of the genetic content by a single nucleotide. Fo...
Q: What are functions of chromosomes?
A: Nucleic acids are macromolecules comprised of carbon, hydrogen, oxygen, nitrogen, and phosphorus. Th...
Q: is an example for aldotriose.
A: The question is about the functional group that out of given example which is the example of aldotri...
Q: D. Barfoed's Test 1. Describe the evidence for a positive test. 2. What does a positive test indicat...
A: Barfoed's test was introduced by Thomas Barfoed. This test is used for the detection of the presence...
Q: 1. Place 5 mL of starch solution in the test tubes. 2. Heat the test tubes to boiling and add to 1 ...
A: The food we consume is broken down to simpler molecules that are used to yield energy for the body. ...
Q: In First order, the rate of reaction would be . ., if the concertation of an enzyme is increased by ...
A: The reaction may be classified according to the order of reaction, which is the number of reacting s...
Q: If you have a protein kinase that is regulated by both small molecule inhibitors as well as by phosp...
A: Protein kinases is enzyme which catalyses the transfer of phosphate between their substrates. A prot...
Q: Describe the relationship between unsaturated and saturated lipids and their physical properties.
A: A biological membrane having polar lipids as an essential component includes phospholipids a...
Q: Ions will flow _________ a concentration gradient. Around Up Down Parallel to
A: The movement of ions depends on the concentration gradient of the ion across a membrane.
Q: Combine these amino acids into a tripeptide. Add or remove atoms and bonds as needed.
A: A tripeptide is a peptide composed of three amino acid linked together via peptide linkages.
Q: Is the phosphate functional group negatively charged in both a non-cellular and cellular environment...
A: A phosphate group is an important group that helps in the formation and hydrolysis of ATP molecules....
Q: Clathrin- Carrier protein dependent receptor mediated endocytosis pump Involvement of multiple types...
A: Transport across the plasma membrane involves various transporters pumps and vesicle mediated transp...
Q: The number of high-affinity binding sites in the T form of hemoglobin is _______ The number of low-a...
A: Hemoglobin T-state is described as deoxygenated state also called deoxyhemoglobin and have low affin...
Q: Help with #4 thanks
A: Enzymes are proteins that aid in the speeding up of metabolic reactions. Certain chemicals can slow ...
Q: The enzymes that are involved in regulation and control of pathways are. . *
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that ...
Q: 2. Several techniques were used to study the degree of translocation of truncated intermediates in t...
A: Here translocation is defined as synthesis of protein by ribosome-tRNA complex as it moves on mRNA u...
Q: 1. Would you say that indicator tests are qualitative or quantitative? Explain your answer.
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: How many different components make up a nucleoside? 4 2 3 5
A: Nucleosides are glycosylamines that are phosphorylated to form nucleotides.
Q: a. You selectively label phospholipids with a fluorescent dye and perform the FRAP assay. You detect...
A: FRAP is a method to determine the diffusion or kinetics of the biomolecule through tissue or cells. ...
Q: What risks are involved in genetic engineering of crop plants? How do these risks compare with other...
A: Genetic engineering is a technique where the genes are edited or newly genes are inserted using gene...
Q: 2. Circle & Name functional groups C-C-N но H. CH2 CH H,c CH3 HICI
A: The structure given is of the amino acid valine. Valine is a non-polar aliphatic amino acid. Functio...
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,...
A: Small molecules called amino acids to form the building blocks of proteins. In chemistry, an amino a...
Q: How many different chemical units make up a nucleoside? (А) 5 в) 2 c) 4 D) 3
A: We are authorized to answer one question at a time, since you have not mentioned which question you ...
Q: Draw the chair conformation of B-D-Altropyranose given the structure of D- Altrose. (Upload your ans...
A: Chair conformation is the most stable structure of a cyclohexane ring. in the chair conformation, th...
Q: what is the importance of getting rf value in chromotography tools?
A: Chromatography: Chromatography is an analytical technique in which compounds in a mixture are separ...
Q: Regulation of glycolysis pathway involves. . Allosteric inhibition by ATP Allosteric stimulation by ...
A: The important regulatory enzyme of Glycolysis is PFK-1 and at this stage one ATP is generated. In ca...
Q: You perform a Bradford assay. You obtain the absorbance values listed below from the BSA samples; yo...
A: Protein quantitation is very important process before processing protein samples for further experim...
Step by step
Solved in 3 steps with 1 images
- The synthetic unit of the polymerase chain reaction is the replica. True or false?What are the essential requirements for the polymerase chain reaction#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
- how do the high temperature affect polymerase to make a mistake as our body temperature will not be too high?#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:How many different temperatures are used in each cycle of the polymerase chain reaction?
- What is the purpose and benefit of the polymerase chain reaction?Find the complement DNA sequences to the following DNA sequences:Sequence # 1: GATATAGTSequence # 2: GAGGTTCSequence # 3: AACTAGATSequence # 4: CCTATAAGSequence # 5: AACGTGATWhat is the DNA template of the following DNA coding: ATGGCTAACCTTGTA
- You set aside some of your purified PCR product to run on a gel. Name two things we learn by running our DNA on an agarose gel electrophoresis?In the "Bacterial Transformation" experiment, why were there no fluorescence bacteria present in the other plates even though these were inserted by the +pGLO plasmid? (Note: Discuss the importance on the addition of ampicillin and arabinose to the medium of the genetically engineered bacteria). Limit your answer to 1-3 sentences only.Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’