Your task in this assignment is to implement and analyze efficient OMP program for fast application of 2D filters. 2D filters are frequently used in image and signal processing, and hence their efficient implementations are highly desired. Let us assume that our input image is represented by n x m array A, and let K be a kernel – a square matrix (for simplicity we will assume that K is always 3 x 3 matrix). In classic 2D filtering with kernel K, for each pixel A;j we compute convolution between K and submatrix of A centered around A¡j. If you recall our lectures, this falls under the category of stencil pattern. In this assignment, we will consider a slightly modified version of the problem. Let A;-1;i+1,j–1:j+1 be submatrix of A centered at (i, j). Then our filter will be defined as follows. First, Z = A;-1;i+1,j–1:j+1 × K, then we obtain the filtered value A', = Eab Zab. In other words, first we compute matrix product between submatrix of A centered at (i, j) and kernel K, then we sum up all elements of the resulting matrix Z. Note that we do not apply the filter to the first and last row/column of A, i.e., A, = Aij if i refers to the first/last row, or j refers to the first/last column. The assignment consists of two parts. In the first question (Q1), starting from the provided backbone (see below) you have to write a C++/OMP code implementing filter as explained above. In the second question (Q2), you have to analyze performance of your solution, generate a speedup plot showing scalability of your code, and then provide a brief discussion summarizing your findings (e.g., do you think your code is scalable, is it always scalable, if it is scalable in what sense, if it is not scalable what do you think is causing problems.).

Write a C++ program incorporating recursion to solve the following problem. The program should compile and execute under the UNIX gcc or g++ environments. (show this please) In this program it needs to accept a sequence of k characters from the user and use the characters to produce a k concentric squares. Also assume that there is an index origin of 1, the outermost square is made up of the letter a[k], the square inside that is made from the letter a[k-1], the square inside that is made from the letter a[k-2], and so on, with the innermost square made from the letter a[1]. For example, if k=5, and the values of a are ("R","O","C","K","Y") then the executed program should display:   Y Y Y Y Y Y Y Y Y Y K K K K K K K Y Y K C C C C C K Y Y K C O O O C K Y Y K C O R O C K Y Y K C O O O C K Y Y K C C C C C K Y Y K K K K K K K Y Y Y Y Y Y Y Y Y Y To make this program simpiler to do if you implement it in C++ and write a class; instances of this class can be passed by value. If a class is…

I need this function to be defined using Haskell language.  Hailstone sequences are produced by repeatedly applying the following mapping to numbers: an even number n maps to n/2 and an odd number m maps to 3m+1.The function hailmap applies this transformation to a single integer.hailmap :: Integer -> Integerhailmap n = undefined Note: when the function is called using an integer the answer will be given based on the number being odd or even. -- ghci> hailmap 7-- 22-- ghci> hailmap 8-- 4 Note: Use div rather than / for division, to avoid the need for conversion between numeric types.-- ghci> 15 `div` 2-- 7

Help with this. Solve the Heads-or-Tails problem in C or C++. Read the H-or-T data from either a file or from STDIN. Reportthe result and related statistics to STDOUT. Report any errors to STDERR:a. In an effort to find something to do during self-quarantine, your friend flips a coin many times andcarefully records the result of each flip in a character vector using either H or T. Write a functionprogram called longestRun that reads these characters from a file and then analyzes them to find thelargest number of consecutive heads or tails. It must return/display two values: (1) the numbercorresponding to how many max consecutive heads or tails were thrown in a row and (2) thecharacter H or T depending upon whether it was Heads or Tails that was thrown the most times. Inthe event of a tie for the longest run, return the character B for both     the text file is  HTHHTTTHHTHHHTHTHTHHHHHTTHHHHHHHHHHHHTTTTTTTTTH

Provide Full C++ Code In this checkpoint, your goal is to find the longest consecutive sequence of a STR (Short Tandem Repeats) in a DNA sequence. The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should…