Zidovudine and Stavudine are nucleoside reverse transcriptase inhibitors which consists of a deoxythymidine analogue. Show an outline of a general synthetic protocol to produce an analogue within this series.
Q: . This cell is dependent solely on glucose as an energy source a.Muscle cells b.Kidney cells…
A: 1. the cell that solely dependent on glucose source is- Answer- d. brain cells Glucose in human…
Q: What amino acid side chains can be modified by methyl groups? What is unusual about methyl group…
A: What amino acid side chains can be modified by methyl groups? Answer: Methylation is a process of…
Q: What is the effect of a defective a(1→ 4) phosphatase in Pompe's disease (GSD II)? O Accumulation of…
A: Glycogen Storage Disease type II , also called Pompe's disease occurs to due to the deficiency of…
Q: In a study, an undergraduate student discovered a new enzyme involved in the metabolism of…
A: Enzymes are usually protein molecules which catalyzes several biochemical reactions. It works as a…
Q: Which histone is present in a chromatosome? H1 H2A O H3
A: Chromatin is a macromolecular structure in eukaryotic cells that is mostly made up of DNA and…
Q: In which type of segregation, genetic information is gained? Alternate Adjacent Both None
A: Principle of Segregation genes explains how pairs of gene variants are separated into reproductive…
Q: Write the reactions of the TCA cycle, naming all enzymes and providing the structural formulas of…
A: TCA cycle ( tricarboxylic acid cycle) is also known as citric acid cycle or Krebs cycle. It occurs…
Q: D-galactose from B-D-glucose can be differentiated using which method of analysis?
A: Glucose and galactose are carbohydrates. Galactose and glucose are examples of monosaccharides.…
Q: Linear homoglycan of glucose connected by α1-4 linkages…
A: Polyssacharides are the long chains of carbohydrate molecules which are composed of several units of…
Q: Question 13 Which of the following can determine location of glysosidic linkages? O Polarimetric…
A: A glycosidic linkage or bond is a type of covalent bond that joins the carbohydrate or sugar…
Q: As the strands are synthesized in replication, which of the following is true? the leading strand…
A: Replication:- process of formation of replica's of DNA in a semiconservative manner. Bidirectional…
Q: A280/ A260 of 1.3. Estimate the pro 1. A solution of a purified protein yielded 0ontration of the…
A: Standard curves of purified reference proteins are used to determine the concentration of the…
Q: Which of the following X-ray diffractograms was obtained from "wetter" DNA fibres?
A: X Ray diffraction is a nondestructive process which provides data about crystalline structure ,…
Q: Which of the following is true of ribosome rescue? (C & E wrong) A. The process produces a protein…
A: Ribosomes are present in prokaryotes as well as eukaryotes. mammalian…
Q: Unsaturated fatty acids have ----. Question 16 options: multiple amide groups in their…
A: Fatty acids are the simplest form of lipids and serve as constituents in a large number of complex…
Q: 1. In human diet, all cholesterol comes from Animal products Vegetable products Both A and B None of…
A: "Since you have posted multiple question we will answer the first question for you. If you want any…
Q: How many ATP and NADH molecules would be produced during the citric acid cycle if 3 molecules of…
A: Cells are the basic unit of life. Cells derive energy from the metabolism of biomolecules such as…
Q: tफकाटक ननी वकट नवींणणणणय हैमकजनाययळे प्B fAtzeorgating a) it is mare highly hydrated. are pressture…
A: The hydrophobic interaction is critical for the stability of several bioactive systems and plays a…
Q: Label the N-terminal and the C-terminal in the above peptide.
A: The amino acid residue on one end of a peptide molecule does have an amine group on the alpha…
Q: ОРОЗ CH2 OH ОН ОН ÓH
A: In the given molecule a phosphate group is attached to a monosaccharide at the 6th carbon.…
Q: Fill up the table by giving examples of common food, their pH range and classification (acidic…
A: The food items we consume are of different pH ranges. The acidic food items are responsible for…
Q: Using punnet square, determine the chances of an autosomal recessive trait produced from the cross…
A: The Punnett square is used for the determination of genotype. Punnett square is a square diagram in…
Q: In the space below, draw the structural diagram of the molecule that hexokinase phosphorylates into…
A: Glycolysis is a metabolic mechanism and anaerobic energy source found in practically all living…
Q: Name the complexes of the ETC, electron donor, and determine the number of H+ ions that are pumped…
A: Electron transport chain and chemiosmosis are part of oxidative phosphorylation. Oxidative…
Q: Describe the pyrimidine biosynthesis pathway
A: Pyrimidines are the nitrogenous base of DNA & RNA. For DNA , pyrimidines are Thymine , Cytosine…
Q: What is the name of proteins that hold DNA in coils or V shapes in Bacteria?
A: SMC : SMC is structural chromosome maintenance .These complexes belongs to the family of ATPases…
Q: Which of the following is not a net product (i.e. of both phases) of the pentose phosphate shunt?…
A: Pentose phosphate pathway involves two phases , oxidative and non oxidative . It is a primary…
Q: (b) The results in the table below were extracted from clinical reports of pediatric age infants (3…
A: Pyruvate Dehydrogenase (PDH) complex contains 3 enzymes within it. Hence they are commonly referred…
Q: Select all the true statements about sequential versus concerted models of allostery. Group of…
A: Allostery is a property of biological molecules of transmission of the effect of binding from one…
Q: In contrast to resting cells, muscle tissue in an active metabolic state will have ___________…
A: Muscles are referred to as the source of contact addresses of the body that are principally…
Q: Key features of signal transduction mechanisms are: specificity, amplification, integration and…
A: Receptors are present in the body. The drug molecules are bound to such receptors and show their…
Q: If you set up an in vitro translation reaction containing poly(ACGU), as template, which of the…
A: A three letter codon is a sequence of DNA or RNA that corresponds to a specific amino acid.
Q: Match the following methods of Anlaysis v Fractional analysis, methylation, and periodate oxidation…
A: Different chemical, physical and enzymatic methods in several applications of biological, chemical…
Q: What is the name of proteins that relax supercoiled state of a DNA molecule are called? Polymerase…
A: During the process of transcription and DNA replication overwinding of the DNA duplex would lead to…
Q: 5. Which of the following enzymes catalyze the ADP-ribosylation of key cellular enzymes or proteins?…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: What is the composition of minimal initiation complex during transcription? TBP, TAF, TFIIA, TFIIB,…
A: In eukaryotes several transcription factors are necessary for the basal expression of an eukaryotic…
Q: Does urinalysis prove the presence of disorder or disease? Explain
A: In many animals and humans, a liquid by-product of metabolism is urine. urine is…
Q: How many ATP and NADH molecules would be produced during the citric acid cycle if 3 molecules of…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: Which isotope did Hershey and Chase use to label the nucleic acid in bacteriophage T2
A: Alfred Hershey and Martha Chase experiments performed a series of experiments in 1952 which helped…
Q: Describe the endogenous mechanisms that regulate cholesterol synthesis.
A: Regulation is a process, where enzymes are activated or inhibited to carry out certain process or…
Q: Question 4 a-D-galactose from B-D-glucose can be differentiated using which method of analysis? O…
A: Alpha - D - Glucose and Beta - D - Glucose are the two cyclic hemiacetal forms of D - Glucose,…
Q: Benefits of a project "Drinking Water Refilling Station " to individuals and families and community…
A: Refilling stations for water bottles are now one of the most popular methods of decrease the…
Q: Outline the role of amino acids as precursors of other nitrogen-containing compounds in the cell,…
A: Amino acids have a major role to form nitrogen-containing compounds in the cells. As an example,…
Q: (d) Identify a wax from the list of compounds shown. ____________ (e) Identify a diglyceride from…
A: The three principal categories of lipids are phospholipids , sterols, and triglycerides.
Q: Based on the structural properties of your protein above , how resistant (or sensitive) would your…
A: Salmonella enterica serovar typhimurium produces 2-keto-3-deoxygluconate 6-phosphate in the…
Q: Match each Sl unit to the quantity it measures. degree Fahrenheit second gram kelvin nanosecond…
A: A unit of measurement is a conventionally defined magnitude of a quantity, that is used as a…
Q: The following bond makes bovine pancreatic trypsin inhibitor as one of the stable proteins.…
A: Introduction: Bovine pancreatic trypsin inhibitor (BPTI) binds to trypsin and prevents peptide…
Q: 1. The allosteric inhibitor of an enzyme a) Causes the enzyme to work faster b) Binds to the active…
A: Inhibitors bind the enzyme and decrease the catalytic activity of the enzyme. The inhibitors may be…
Q: Complete the table by simply identifying only one example in each type of carbohydrate.
A: Monosaccharides - it is a basic unit of polysaccharides or carbohydrates, which cannot be broken…
Q: Which of the following statements is TRUE regarding the ABO blood system? People who have the…
A: There are 4 main blood groups A, B, AB and O and each of these groups can be either RhD positive or…
Step by step
Solved in 2 steps with 1 images
- Describe the molecule shown in the image. Evaluation at Atomic Resolution of the Role of Strain in Destabilizing the Temperature Sensitive T4 Lysozyme Mutant Arg96-->HisWhat are histone deacetylase inhibitors (HDACi)? Give example(s)Azidothymidine is a Thymidine analog used to inhibit viral reverse transcriptase. Explain the application of this nucleoside analog as an antiviral drug and how it affects reverse transcription and therefore block the ability of the virus to hijack the host cell
- How does the action and mutagenic effect of 5-Bromouracil differ from that of nitrous acid? explain.5-Bromouracil is an analogue of thymine that usually pairswith adenine. However, 5-bromouracil frequently pairs withguanine. Explain.A mutant has no activity for the enzyme isocitrate lyase.Does this result prove that the mutation is in the geneencoding isocitrate lyase?
- Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG AUU CUG GAA AUU ACC UCC AUC AUG AAG CGC UGA CCC AUU AUU AA - 3'If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualWhich of the following would be a good chemotherapy approach: blocking formationof the ribonucleotide GTP or blocking formation of the deoxyribonucleotide dGTP?Why? Please explain the chemical differences between each of the two nucleotides. Use the specific processes below to support your choice by explaining how either GTP or dGTPare related to these and how loss of the particular molecule would affect each process. *PEP carboxykinase in gluconeogenesis*Succinyl-CoA synthetase in the TCA Cycle*Glucagon signal transduction
- complete steps of haworth projection of D-tagatoseIdentify possible sequences of both overdoses and underdoses of amoxicillin.Which of the following correctly describes the regulation and activity of HIF-1? Group of answer choices VHL is required for preventing degradation of HIF-1alpha and promoting translocation to the nucleus In normoxia, HIF-1alpha is ubquitinated and degraded in the proteasome Hypoxic conditions result in increase hydroxylation of prolines in HIF-1alpha The primary function of HIF-1 is to phosphorylate and activate glycolytic enzymes