Determine the complementary strand of DNA that forms on this template DNA fragment during replication: 5′GGTTTCTTCAAGAGA3′

Q: Describe the discontinuous synthesis of the lagging strand in DNA replication.

A: During the process of replication of DNA, each of the parental DNA strands is used as a template.

Q: Match Column A  (Description) with Column B (protein/enzyme)

A: One new strand (the leading strand) is created as a continuous segment during DNA replication. The…

Q: Identify the template and non-template strand on the DNA. B TACGGATACG UACGGAUA ATGCCTATGC

A:

Q: During DNA replication, the Okazaki fragments are Select one: O a. single-strand RNA O b. RNA-DNA…

A: Option c

Q: Using recycled papers and sticks, demonstrate the steps of DNA replication. Use the following…

A: During replication, a double-stranded DNA molecule is duplicated to produce two identical DNA…

Q: In one, simple sentence define the function of the following 1. Helicase  =  2. Alpha subunit of…

A: DNA helicases are essential during DNA replication because they separate double-stranded DNA into…

Q: Describe the types of noncovalent interactions that stabilize DNA structure.

A: A non-covalent interaction differs from a covalent bond in that it does not involve the sharing of…

Q: Escherichia coli (E. coli) has one replication origin that contains specific genomic sequences…

A: DNA replication It is defined as the process through which the copying of DNA takes place in cells.…

Q: DNA repair enzymes that correct deamination and depurination must preferentially recognize these…

A: DNA damage occurs when negative changes occurs in DNA due to endogenous or exogenous factors,  The…

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: Why is DNA gyrase necessary for replication?

A: DNA gyrase is an enzyme of class topoisomerase and subclass of topoisomerase type II. DNA…

Q: With regard to DNA replication, define the term bidirectional replication.

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: Within the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC.…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: Explain why the bending of the double helix to form a superhelix falls into the area of geometry or…

A: Nucleic acids are important biomolecules. Nucleic acids are of two types. These are DNA…

Q: Calculate the length of the DNA of bacteriophage lambda that has 48502 base pairs.

A: Introduction: DNA stands for deoxyribonucleic acid and is a form of nucleic acid. Except for a few…

Q: You have determined that the newly synthesized strand of DNA in your sequencing reaction has the…

A: Template Strand will be: 3' TGATGGCTCA5'

Q: Which bacterial enzyme is responsible for removing the RNA primer of an Okazaki fragment and…

A: Replication is the process which is responsible for synthesis of DNA from the parent strand.

Q: Make a side-by-side drawing of two DNA helices: one with 10 bpper 360° turn and the other with 15 bp…

A: Answer: Introduction: DNA deoxyribose nucleic acid, it is a molecule that contains the information…

Q: the initiation of replication in prokaryotes? Id

A: Prokaryotes can be defined as organisms whose cells lack a nucleus and other organelles. Most of the…

Q: Draw the syn conformation of purine residues in Z-DNA.

A:

Q: Describe the activities of the enzymes required to construct a recombinant DNA molecule.

A: Genetic engineering is the major area for the production of recombinant DNA. The recombinant DNA is…

Q: If a bacterial (E. coli) cell has 50,000 bp, how long will be a normal DNA replication?

A: Different macromolecules are present in the body, and they include carbohydrates, proteins, lipids,…

Q: . Indicate the role of each of the following in DNA replication: (a) topoisomerase, (b) helicase,…

A: The deoxyribonucleic acid (DNA) is a hereditary material that is found in almost all living…

Q: A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: With illustrative diagrams, explain the three theories of DNA replication.

A: The DNA replication is the process of formation of DNA in which one strand of DNA act as the…

Q: Name the enzymes that cut the DNA at specific sequences and create sticky ends.

A: A substance produced by a living organism that acts as a catalyst to bring about a specific…

Q: Provide the sequence of the primer that is complementary to the DNA in each of the following…

A: Site A: 5' CTATGCGCTA 3'

Q: DNA polymerases cannot initiate DNA synthesis without a primer, a section of nucleic acid having a…

A: Primase is an RNA polymerase which produce short strand of primer required by DNA polymerase in DNA…

Q: Describe the movement of the open complex along the DNA.

A: The open complex is used in the process of transcription when the DNA template is used to produce…

Q: elow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA…

A: Without the enzymes, DNA replication is incomplete. The initiation, elongation, termination, and…

Q: As the strands are synthesized in replication, which of the following is true?

A: The process of in which DNA molecule produce exact copy or replica of itself is known as the…

Q: Explain, If the template strand of a DNA is 3’-ATCATG-5’, what will be the complementary strand?

A: The DNA or deoxyribonucleic acid is the genetic material of all the living organisms and it is…

Q: During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer…

A: Ligase unwinds the helical structure of DNA. Topoisomerase breaks the pressure of supercoiling in…

Q: Define topoisomers of circular DNA molecules and explain the relationship between twist and writhe…

A: Circular DNA is the DNA molecule that forms closed loops and has no free ends. These includes…

Q: Single-stranded regions of DNA are attacked by nucleases in the cell, yet portions of DNA are in a…

A: DNA replication is the process of production of identical copies of the DNA sequences. It is…

Q: Explain what is meant by the antiparallel polarity of the two strands of DNA within the double…

A: Double helix can be defined as the structure of a DNA molecule. The DNA molecule consists of two…

Q: Explain why DNA replication is slightly slower in the lagging strand of DNA than in the leading…

A: DNA replication is slightly slower in the lagging strand of DNA than in the leading strand, the…

Q: What factors promote the fidelity of replication during the synthesis of the leading strand of DNA?…

A: Factors which promote the fidelity of replication are DNA polymerase enzyme ,mismatch repair system…

Q: List the differences and similarities in the way the twodaughter strands of DNA are synthesized at a…

A: DNA (deoxyribonucleic acid) is the genetic material of almost all living organisms. It is a double…

Q: Define the bidirectional replication in DNA.

A: DNA is a that is two-stranded molecule which is usually having complementary base pairing among…

Q: In eukaryotes, the Replication factor C (RFC) is a clamp loader. In the absence of RFC, what would…

A: The Replication factor C (RFC) is the accessory proteins that's is essential for the processive DNA…

Q: Why is it necessary to unwind the DNA helix in the replication process?

A: DNA replication is the process by which a double stranded DNA molecule is copied to produce two…

Q: What is the difference in DNA replicatoin on the leading strand versus the lagging strand?

A: DNA replication is a semi-discontinuous process as one strand is synthesized continuously whereas…

Q: Explain why two metal ions play important role on the palm domain of DNA polymerase.

A: Please follow step 2 for detailed explanation.

Q: Explain how base stacking and additional twisting further stabilize the DNA double helix

A: Deoxyribonucleic acid (DNA) is one of the important biomolecules. It is a long chainlike molecule…

Q: What size DNA fragment would be released after very mild digestion of chromatin with micrococcal…

A: Introduction  Micrococcal nuclease in as example of endo-exonuclease which is obtained from…

Q: Name an important difference in the replication of circular DNA versus linear double-stranded DNA.

A: Replication: Replication is the process to copy old DNA  into new DNA strands (genetic material),…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.