During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer and the first incoming deoxyribonucleotide for an Okazaki fragment on the lagging strand? topoisomerase DNA polymerase III DNA helicase DNA polymerase II DNA ligase Heterogeneous nuclear RNA is typically characterized by which of the following features?

During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer and the first incoming deoxyribonucleotide for an Okazaki fragment on the lagging strand? topoisomerase DNA polymerase III DNA helicase DNA polymerase II DNA ligase Heterogeneous nuclear RNA is typically characterized by which of the following features?

Name: During DNA replication in E. coli, which enzyme forms the phosphodiest
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer and the first incoming deoxyribonucleotide for an Okazaki fragment on the lagging strand? topoisomeraseDNA polymerase IIIDNA helicaseDNA polymerase II

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 15CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’

See similar textbooks

Similar questions

. Which of the following enzymes can break, and rejoin, phosphodiester bonds during the normal DNA replication process in the chromosomes of E. coli cells? single-stranded binding proteins RNA polymerase topoisomerase DNA helicase DNA ligase The mutation causing sickle-cell anemia in humans, which changes the normal T to an A in the sixth codon (substituting valine for glutamic acid), occurs in which gene of the hemoglobin family? the a-globin gene (alpha) the b-globin gene (beta) the g-globin gene (gamma) the d-globin gene (delta) the e-globin gene (epsilon) The hypermutable condition, which allows cells to “play the lottery” by lowering the fidelity of DNA replication, was first discovered in which of the following prokaryotes? Saccharomyces cerevisiae Amoeba dubia Drosophila melanogaster Homo sapiens Escherichia coli
A scientist successfully analyzed a new micro-organism. Because this micro-organism contains double-stranded DNA as genetic material, Meselson-Stahl techniques was employed. The following shows the results of the experiment where L – light chain (14N) and H – heavy chain (15N).What is the mechanism of replication in this organism in the picture? Explain how you got the answer. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’. Accidentally, you forget to include dATP in the four reactions that contain a ddNTP. What is the sequence of the daughter strand produced from this sequencing activity? Show the process. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’. Accidentally, you forget to include dATP in the four reactions that contain a ddNTP. How many bands will appear in the lane containing ddATP? Show the process. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’.…
E. coli cells grown on 15N medium are transferred to 14N mediumand allowed to grow for two more generations (two rounds ofDNA replication). DNA extracted from these cells is centrifuged.What density distribution of DNA would you expect in thisexperiment?(A) one high-density and one low-density band(B) one intermediate-density band(C) one high-density and one intermediate-density band(D) one low-density and one intermediate-density band
Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA? Because it is entropically unfavorable Because that would cause a steric clash between the sugars and nucleobases Because that would cause a steric clash between the 2' OHs of the sugars and the phosphates Because uracil can't form hydrogen bonds with any other nucleobases
he Meselson and Stahl experiment provided conclusive evidence for the semiconservative replication of DNA in E. coli. What pattern of bands would they have observed in a CsCl gradient after one generation if replication was conservative? a heavy, a light and an intermediate band one heavy and one light band (no intermediate) one intermediate band one light band one heavy band
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
Aflatoxin B1 is a highly mutagenic and carcinogenic compound produced by certain fungi that infect crops such as peanuts. Aflatoxin is a large, bulky molecule that chemically bonds to the base guanine (G) to form the aflatoxin-guanine adduct that is pictured below. In the figure below, the aflatoxin is orange, and the guanine base is purple. This adduct distorts the DNA double helix and blocks replication. a. What type(s) of DNA repair system is (are) most likely to be involved in repairing the damage caused by exposure of DNA to aflatoxin B1? b, Recent evidence suggests that the adduct of guanine and aflatoxin B1 can attack the bond that connects it to deoxyribose; this liberates the adducted base, forming an apurinic site. How does this new information change your answer to part (a)?
During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer and the first incoming deoxyribonucleotide for an Okazaki fragment on the lagging strand? topoisomerase DNA polymerase III DNA helicase DNA polymerase II DNA ligase
If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? 5'-TGACTAACTG-3' 3'-TGACTAACTG-5' 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5'
In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA glycosylase AP endonuclease photolyase AlkB UvrABC proteins If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is: constructive semiconservative conservative consecutive cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair? DNA polymerase I DNA polymerase II DNA polymerase IV DNA polymerase V none of the above
What are some of the ways that organisms use to ensure the fidelity of DNA replication? Why is it important that the fidelity of DNA replication is an evolutionary balance between faithful replication and the existence of some errors? Escherichia coli and other bacteria methylate adenines on the original strand to distinguish the original strand from the newly replicated strand of DNA. Why is this distinction important?
In E.coli, the following enzymes do NOT synthesize the RNA primer for Okazaki fragments? A.DnaA B. DnaC C.DnaG D.None of the above