BPS 2110 mid-term 1 2023 answers

How can the composition of nanoparticles be inferred? Briefly describe how to diagnose nanoparticles Explain how nanoparticles are used in medicine and pharmacology Number of biological methods for preparing nanoparticles Explain how each method is done P 8:08 V

Please answer the following questions?

P 12 D 12 D. cold bet.p + Who bet P Frien roblc Hom S STAR + ays/1089903/lessons/1533963/variants/2428136/take/15/ A e * Practice TEXT ANSWER Answer the following three questions based on the diagram below. 1. Which of the pictured organisms is a eukaryote? Explain your answer using evidence from the diagrams. 2. Describe two similarities between the cells of prokaryotes and eukaryotes. 3. Describe one difference between the cells of prokaryotes and eukaryotes. You may not use the evidence you described in the first question. Amoeba Bacterium DNA Nucleus (Na to scales Write your answers using 3 to 4 complete sentences. H. = = = = S x, x E E A A Normal BIUS Enter your answer here 22222222 All Changes Saved ons Answered 52°F Clear

please solve this step by step calculations

i need the answer quickly

Biology Questions The questions are showed in the attached pictures.

A 5. Macrolides: a. Which step in protein synthesis does this class of drugs inhibit? b. Do you think this class of drugs would be more effective in blocking the synthesis of small or large proteins? Why? !!

a. State the importance of using following reagents in SDS-PAGE. 1. Acrylamide 2. Bisacrylamide 3. Tetramethylethylelediamine 4. Glycerol 5. Ammonium persulfate b. Briefly describe the importance of two dimensional electrophoresis in protein separation?

Soon answer the same?  What properties of drug are relevant for developing modified release drug delivery formulation. Please briefly explain this at your own words.

solve 1 please ..

HELP!..

please help asap

Peptide Sequencing Answer numbers 1 and 2. For number 2, show the OVERLAP method.

Does RCSB PDB contain structural details of other biomolecules like nucleic acids, lipids, and carbohydrates? A. True B. False

Part B/D?

Please answer all questions GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homolog).10. Generate a secondary structure prediction for one identified protein.

Activity 1 Activity 2 Activity 3 Activity 4

d/e/1FAIpQLSfTle9UfP15_VUqFI-ACEQd1XBykXv5Lr4dEMQbLJ1d6fCupw/viewform Students subjected three samples of five different molecules to gel electrophoresis as shown in Figure 1 A B C DE +2 3 Wells 4 8. Which of the following statements best explains the pattern seen on the * gel with regard to the size and charge of molecules A and B? 1 point molecules A and B are positively charged, and molecule A is smaller than molecule B. molecules A and B are positively charged, and molecule A is larger than molecule B. molecules A and B are negatively charged, and molecule A is smaller than molecule B. molecules A and B are negatively charged, and molecule A is larger than molecule B. Sign out

present briefly the principle of size exclusion chromatography.  give a brief description of the use of protein assays.

9 and 10 please

Life's Instructions Manual: Discussion Questions 1) Why can the genome be thought of as life's instruction manual? 2) What is the difference between a gene and a genome? 3) What is the difference between DNA and a nucleotide? 4) What builds proteins, and what do proteins do?

A. What are the 4 “Koch’s Postulates”?   B. Are they still valid today? How would we use them to establish the relationship between a specific microbe and a disease? Can we substitute such things as finding antibodies or DNA traces for some steps? If so, why? C. How has microbiology contributed to the advancement in molecular biology?

r please show complete solution. do not reject please

Procedure A. Applying the terms of science → The following fictional experiment demonstrates the use of the scientific method. Many people in the small Midwestern town of Hootville are stricken with the disease "Buggo." Most of those who get sick recover in seven to nine days. Buggo has been shown to be caused by a bacterium (single for bacteria) called "Gotcha." Antibiotic "X" is a new drug that has been shown to kill Gotcha bacteria in a test tube. Antibiotic X was also found to cure dogs that were sick with Buggo. 3 #m Researchers decided to test the new drug on some of the people in Hootville. They hypothesized that the drug would effectively cure Buggo in humans. They decided that if they gave patients Antibiotic X, the patients would recover more quickly than those who did not take the antibiotic. The researchers prepared tablets containing Antibiotic X. They also prepared a second batch that contained all the same ingredients (inactive ingredients) as Antibiotic X without any…

Further discussion questions: a) What is the wavelength of UV light with maximal absorbance by purified protein? Which amino acid(s) in protein has/ have the highest absorbance at this wavelength? b) Name and briefly describe two methods (other than UV absorbance) to detect proteins in a sample.

ull MTN-Stay Safe LTE 10:13 AM @ 34% #3 Mol Bio Gene o... Complete the following tasks. You discovered that a species of bacteria can break down Styrofoam™ (polystyrene) products due to an enzyme it produces, polystyrenase. You wish to study the gene that codes for this enzyme. Task 1: DNA Extraction To begin work on the bacterium, you begin by extracting its genomic DNA (gDNA). What is the purpose of the following procedures? Answer briefly but completely. Using sodium dodecyl sulfate, a detergent Answer: а. b. Adding RNase A and Proteinase K during extraction Answer: c. Adding ethanol before recovering the DNA extract Answer: Task 2: Polymerase Chain Reaction After purifying the gDNA extract, you want to isolate and amplify the polystyrenase gene. You perform PCR using the appropriate gene-targeted primers. What is the purpose of the following PCR compon briefly but completely. Answer DNA polymerase isolated from Thermus aquaticus а. Answer: b. Deoxynucleotide triphosphates (DNTPS)…

Ch 15 Pro Q1 Homework • Unanswered • Due Mar 31st, 11:59 PM Transcription Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a a) copies of sequences of DNA into an RNA molecule b b) occurs in the cytoplasm of a eukaryotic cell c) is catalyzed by a DNA polymerase d d) none of the above Unanswered Submit

SET 1: PEPTIDE SEQUENCING BY ENZYME DEGRADATION AND EDMANN TECHNIQUE A. Predict the fragments that will be generated from the treatment of the following peptide with: a.) trypsin b.) chymotrypsin c.) and S. aureus V8 protease G-A-W-R-N-A-K-E-F-G-Q WRITE the fragments in this table: trypsin chymotrypsin S. aureus V8 protease G-A-W-R; N-A-K; E-F-G-Q G-A-W; R-N-A-K-E-F; G-Q G-A-W-R-N; A-K-E; F-G-Q B. The sequence of a 29 aa long peptide can be determined from the following data: Treatment of the peptide with dansyl chloride reveals that the amino terminal is Val. а. b. Trypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: T1 V-G-A-H-A-G-E-Y-G-A-E-A-T-E C- Terminal Peptide fragment T2 A-A-W-G-K & T4 T-N-V-K middle peptide fragments T3 V-L-S-P-A-K N-Terminal Peptide fragment c. Chymotrypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: C1 G-A-E-A-T-E C- Terminal…