INFO_Packet_2024

Identify the type of base and sugar group present in each nucleotide or nucleoside. HO. H3C. CH₂ OH -²03POCH2 OH 'N N ΝΗ NH₂ Molecule 1 O pyrimidine, deoxyribose O pyrimidine, ribose purine, ribose O purine, deoxyribose Molecule 2 pyrimidine, ribose O pyrimidine, deoxyribose purine, ribose O purine, deoxyribose

Please help with this practice problem!

name and identify

b. What is the difference between the 3' and the 5' ends of a nucleotide chain? C. Do the chains run the same way? d. How are the chains connected? e. Which bases bond to each other? f. What kinds of bonds hold the chain together? 3. What are the main differences between RNA and DNA? 4. Distinguish between the structure of pyrimidines and purines. Explain why adenine bonds only to thymine. 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each base. Then indicate if the base if found in DNA (D), RNA (R), or both (B) hp

H2N 1.) Look carefully at this nucleotide: N: N- Но-Р-О OH a.) Number the carbons in the sugar group. (Remember the "prime" symbols.) b.) Is this a purine or a pyrimidine? How do you know? c.) Would this nucleotide be used for DNA or RNA? How do you know? (Be specific.) d.) Is this nucleotide ready to be used for DNA replication or RNA transcription? Why/why not? e.) If this nucleotide were incorporated into a growing DNA or RNA strand, where would the next added nucleotide be attached to this one?

a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to it so that the complementary bases are side by side. Connect the appropriate base pairs. b. Sticking to the convention of writing the nucleotide sequence in the 5'-3' direction, what is the nucleotide sequence of the DNA strand complementary to ATGCACCATGCT?

E. PROTEIN PRIMARY STRUCTURE ELUCIDATION. 1. Determine the primary structure of the protein described below. Write the final sequence using the corresponding three-letter code for each amino acid. Example: M-F-Y-R should be written as Met-Phe-Tyr-Arg Treatment with cyanogen bromide and sequencing yields the following peptide fragments: o D-M o R-A-Y-G-N o L-F-M Chymotrypsin digestion and sequencing yields the following peptide fragments: o G-N D-M-L-F o M-R-A-Y o o

ture.com/courses/7611/assignments/170598?module_itemid%3D695428 TR E Edulastic: Formativ. A Desmos | Testing O YouTube I Quiz | ReadTheory Quill.org - In О в, С, А, D D, B, A, C C, B, D, A How many nucleotides are represented in the diagram? * 2 points O 6 12 18

Question Guide: 1. Name and write the structures of the purine and pyrimidine bases present in DNA. Purine Рyrimidine Structures: Purine Pyrimidine

Draw atleast 3 structure of nucleotide containing 2 pyrimidine bases and I purine base.

Tick ​​the correct statements:   Remember: Tautomers are structural isomers that differ from each other based on the position of the proton(s) and their double bonds. ( ) The nitrogenous bases of nucleic acids, which contain heterocyclic and analogous nuclei, can adopt different tautomeric forms involving multiple H+ that are exchangeable depending on the medium. In DNA, spontaneous formation of smaller tautomers appears to contribute to mutagenic errors during DNA replication, while in RNA, they seem to be related to increased structural and functional diversity of enzymes and RNA aptamers (research this and confirm if it is false or real) ( ) in relation to the figure, anomer 1 has beta stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) in relation to the figure, anomer 1 has alpha stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) In general, in naturally occurring nucleosides,…

Name the nucleotide.

Pls help

Go to Figure 5.23 a and, for the top three nucleotides, number all the carbons in the sugars, circle the nitrogenous bases, and star the phosphates.

9L.12

N. NH 2. One of the key pieces of information that Watson and Crick used in determining the secondary structure of DNA came from experiments done by E. Chargaff, in which he studied the nucleotide composition of DNA from many different species. O=P-OCH, N. `NH, HN он O= P- OCH, NH, Chargaff noted that the molar quantity of A_was always approximately equal to the molar quantity of T. and the molar quantity of C was always approximately equal to the molar quantity of G. How were Chargaff's results explained by the structural model of DNA proposed by Watson and Crick? N OH N. O= P-OCH, OH OH

Do (9)(a)

(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21

These multiple-choice questions are all related to the Basic Biological Principles (DNA) | Introduction to Biomolecules. Choose the best answer on the given choices.

Give explanation of correct option and explanation of incorrect options. Hand written solutions are strictly prohibited.

Compare and contrast the structure of DNA and RNA.  Be sure to describe each of the three components of a nucleotide for both DNA and RNA along with the types of bonds formed between the components.  In addition, explain: how the nucleotides link together to form each molecule, why the prime ends are labeled 5’ and 3’, what antiparallel is, what phospodiester linkages are and what complementary base pairing is.

Help me please...

Which of the following is true of the molecule below? nucleotide 5' 3′ H₂C H₂C TNHNA O. HN CNH…NG NH O NH O HNU NH O CNHNG OHN nucleoside CH₂ CH₂ a purine pairs with a pyrimidine base the bases are held together by covalent bonds a nucleoside is made of the same components as a nucleotide The bases make up the backbone on the sides of the molecule

Describe the functions of the following proteins during DNA breaks and repair: (i) Ku70 (ii) Uracil DNA glycosylase

(Optional) Describe the structure of DNA, discussing the DNA helix and the base pairs of DNA, the overall structure of a chromosome, the structure of a gene, an mRNA, a ribosome, and a protein. What are the relative sizes of each of these?

A genetics student was asked to draw the chemical structureof an adenine- and thymine-containing dinucleotide derivedfrom DNA. His answer is shown below. The student made morethan six major errors. One of them is circled, numbered 1, andexplained. Find five others. Circle them, number them 2 to 6, andbriefly explain each by following the attached given.

choices:purine or pyrimidine ribose or deoxyribose 1-9? hydrogen or phosphodiester 1-9? an -OH or no -OH 1-9?

Identify the correct name or abbreviation for the given nucleoside or nucleotide. guanosine ADP dADP dGDP GDP Identify the correct name or abbreviation for the given nucleoside or nucleotide. GDP dADP ADP O deoxyadenosine dGDP OMP O || -O-P-O-P-O. fot O™ tt -O-P-O- O™ ܘ ܐ ܘ ܐ OIPIO N OH OH OH N H₂N N ΝΗ N NH₂