MSE7_1

PYTHON # Part 1: Tasks # Info # Bunch of task # Task has status: Not Started, In Progress, Completed # Task can have a prerequisite/parent task # You can’t start a task until prerequisite/parent task is completed # Automatically start the next task when it’s prerequisite/parent is completed # Functionality # Start a task # Complete a task # Example # A -> B -> C, D  # task = {# "status"# "prereq"}

There are two options for ending tasks and preventing deadlocks:

2. First Even Road by CodeChum Admin I've been newly assigned as the city's road planner but this job seems tougher than I thought!   Almost all of the roads in this city are uneven. To fix these, I need to find an even road as a reference. Fortunately, the mayor told me that there's 1 even road somewhere and if I persevere, I could find it.   Could you please help me with this?   Instructions: Your task is to ask the user for the number of rows and columns of a 2D array. Then, print the row number of the row where the sum of all of its elements is even. For this problem, it is guaranteed that there is one and only one such row. Input 1. Number of rows 2. Number of columns 3. Elements of the 2D array Output Note that the row number starts at 0, not 1. Enter # of rows: 3 Enter # of columns: 3 Enter elements: 2 7 4 1 1 2 0 5 0   Even row: 1

2. First Even Road by CodeChum Admin I've been newly assigned as the city's road planner but this job seems tougher than I thought!   Almost all of the roads in this city are uneven. To fix these, I need to find an even road as a reference. Fortunately, the mayor told me that there's 1 even road somewhere and if I persevere, I could find it.   Could you please help me with this?   Instructions: Your task is to ask the user for the number of rows and columns of a 2D array. Then, print the row number of the row where the sum of all of its elements is even. For this problem, it is guaranteed that there is one and only one such row. Input 1. Number of rows 2. Number of columns 3. Elements of the 2D array Output Note that the row number starts at 0, not 1.

2. First Even Road by CodeChum Admin I've been newly assigned as the city's road planner but this job seems tougher than I thought!   Almost all of the roads in this city are uneven. To fix these, I need to find an even road as a reference. Fortunately, the mayor told me that there's 1 even road somewhere and if I persevere, I could find it.   Could you please help me with this?   Instructions: Your task is to ask the user for the number of rows and columns of a 2D array. Then, print the row number of the row where the sum of all of its elements is even. For this problem, it is guaranteed that there is one and only one such row. Input 1. Number of rows 2. Number of columns 3. Elements of the 2D array Output Note that the row number starts at 0, not 1. Enter·#·of·rows:·3 Enter·#·of·columns:·3 Enter·elements: 2·7·4 1·1·2 0·5·0 Even·row:·1

I'am using C language and Codio  OUTPUT: Record 1 Student No.: 202100001 Student Name: Naruto Course: CE Year Level: 1 Record 2 Student No.: 202100002 Student Name: Gokou Course: CPE Year Level: 2 Record 3 Student No.: 202100003 Student Name: Luffy Course: COE Year Level: 1 Record 4 Student No.: 202100004 Student Name: Pikachu Course: CS Year Level: 3 Record 5 Student No.: 202100005 Student Name: Recca Course: ME Year Level: 4 RECORD SUMMARY Student No. Name Course Year Level 202100001 Naruto CE 1 202100002 Gokou CPE 2 202100003 Luffy COE 1 202100004 Pikachu CS 3 202100005 Recca ME 4

OpenGL - computer grahic

Question 9 The postfix equivalent of mathematical expression 9x(5-(3+6)) is the expression + 36 - 5 x 9 the expression x 9 -5 + 36 the expression 9 5 3 6 + - x the expression 6 3 + 5 x 9- arch

Background Once upon a time, in a certain medieval village, a group of mysterious strangers appeared in jeans and T-shirts. The strangers managed to learn enough Old English to explain that they had been enjoying their favourite pastime – belting out tunes at a karaoke party – when they saw a blinding flash and heard a thunderous roar, lost consciousness, and found themselves transported back in time without any explanation. The villagers were most interested in the strangers’ wide-ranging knowledge of popular songs from the future. They understood that the strangers belonged to some sort of bard class. The villagers were also party animals, and had a feast every night. The bards agreed to come to some of the parties and sing one Billboard Top 40 song whenever they did. When they weren’t there, the villagers would sing these songs to each other, reverently, knowing that they held clues to the future of their world. The more they learned, the more they were able to share, and some were…

Test Analyze Tools Extensions Window Help Search (Ctrl+Q) Debug Any CPU Start File Edit View Git Project Build Debug 2-2 Program.cs* + X C# Models.cs I 85 I } Model = model; Year = year; Status = status; // status Notes = notes; 89 90 93 94 68 a # 6 8 bo 63 6$་མཁའ་མ8ར8མཚོ ་བའི་་ཝཱ CarRentalCompany.ProgramA //public bool avaialble { get; private set; } O references public static List CarRent (List rentedVehcile) {// if the car is available, add to a List that says rented return rentedvehcile.Where(v => Car.status).ToList(); 95 96 97 98 99 } 100 O references public void CarReturn() if i 101 { 82% Output Show output from: Build 1 Main(string[] args) Developer PowerShell Package Manager Console Error List Command Window Code Definition Window Output Test Results Test Runs Ready 81° myhp CarRentalCompany zm W Truck.cs + Sign in & Ln: 172 Ch: 6 SPC CRLF Qx Solution Explorer Live Share Search Solution Explorer (Ctrl+;) > Solution 'CarRentalCompany' (1 C# Models.cs Properties C*…

Octave programming language

4 & 5 python

What year did John von Neumann get his PhD from the University of Göttingen?|

Find error

Joe’s Ristoranté is a small restaurant near a college campus. It serves both lunch and dinner from a standard menu. It also has a salad bar. Staff take orders by writing down the orders on an order pad. The orders are then taken to the kitchen where the food is prepared. When the food is ready, the staff are notified and deliver the food to the customer’s table. When the meal is finished, the staff provide customers with a bill, which has been prepared by hand. All sales must be paid by cash or credit card and entered into the cash register. Joe maintains one checking account for all sales receipts. Required: Create an REA diagram for Joe’s order-taking and cash receipts process, including all relationships.

correct answer only

Student Companion ™ is your personal academic guide that provides the following basic information for each course while a student at the USC. Courses done, grades earned, Course outline attachments, course notes etc.This is a simple application to keep track of each course you are doing/have done and can serve as a personal test timetable for the course which has final quiz, keep track of your courses that have etc. The concept is like a personal check sheet system blended with a simple quiz timetable. This also solves a problem that often shows up when students have completed their program and need to revert back to data pertaining to their academic life from their viewpoint. Please note this does not replace a transcript, which is an official University Document. 1. Create a Class Diagram of at least six (6) major entities for your application. For entities with a large number of attributes you are allowed to limit your attributes to a max of six (6). All operations within each class…

Use html, php and Mysql to design a Library Managment web based System The system should be able to do the following:1) Add/Remove/Edit book2) Search Catalog3) Register new account/ cancel membership4) Check-out book5) Reserve book6) Renew a book7) Return a book Three main users for the system:1) Librarian2) Member3) System

Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…

Design a Happy Birthday function view with graphics effects, using OpenGl, (gl/glut)

Description Greetings! Task: Write a program that will ask for the user's name and output their name mixed with a command line argument given as the greeting. Command line args will be formally introduced next week, however, you're encouraged to do some of your own research for this challenge! Python docs: https://docs.python.org/3/library/sys.html#sys.argv PYTHON 1 import sys 2 3 # e.g. $ python main.py foo bar 4 # Arguments would contain: 5 6 sys.argv[0] # => main.py 7 sys.argv[1] % => foo 8 sys.argv[2] # => bar Your program should read the greeting from command line arguments, ask the user for their name, and then output a custom greeting, like so: Example 1 $ python greet.py Yo! What's your name? Jamal Yo! Jamal Example 2 $ python greet.py "G'day" What's your name? Summer G'day Summer Tip: For G'day, be sure to include in double quotes, so Bash treats it as one argument.

Python Automation Script: write a python automation script that scrape gold rate from website automatically: get the latest(today's) gold rate in delhi from the website and change from previous day, and print the result on the screen.