1 Given the following genotypes, explain how the mutation (identified by a () superscript will affect E. coli grown in lactose medium. Will the lac operon be on or off? Will there be a complete set of gene products from the loc operon? What will be the implication of the missing gene product, if ever? Will the cell be able to survive in the lactose medium or not? a. p'o y b.p'o v d. p o y

1 Given the following genotypes, explain how the mutation (identified by a () superscript will affect E. coli grown in lactose medium. Will the lac operon be on or off? Will there be a complete set of gene products from the loc operon? What will be the implication of the missing gene product, if ever? Will the cell be able to survive in the lactose medium or not? a. p'o y b.p'o v d. p o y

Name: Answer the following questions:1. Given the following genotypes, expl
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Answer the following questions:1. Given the following genotypes, explain how the mutation (identified by a () superscript will affect E.coli grown in lactose medium. Will the lac operon be on or off? Will there be a complete set of geneproducts from

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 13TYU: INTERPRET DATA Develop a simple hypothesis that would explain the behavior of each of the following...

See similar textbooks

Similar questions

A strain of E. coli has the genotypes shown below at the lac operon, where I = regulator gene, P = promoter, O = operator, Z = βgalactosidase gene, and Y = permease gene. The superscript+ indicates a wild-type allele,c indicates a constitutive mutation, and− indicates a defective mutation. For each genotype, indicate whether the enzyme will be synthesized or not synthesized when lactose is present or absent by placing a + for synthesis occurring and a − for synthesis not occurring in the appropriate blank. Explain your reasoning for each answer.
You are growing E. coli in a laboratory in order to study their operons. The growth media you are using contains lactose, no glucose and no tryptophan. Using your knowledge of operons and their regulation, answer the following questions I really need a in depth epxplantion for the queshtions to make sure i understand the answers a.What effect does lactose have on the bacterial cell’s lac operon? b.What does the absence of glucose do to the bacterial cell? c.You now add tryptophan to the cell. What would happen to the bacterial cell and its trp operon? d.What kind of regulation does lactose provide to an operon’s repressor?
Answer the following questions based on the lac Operon metabolic pathway. The lac Operon regulates the metabolism of what molecule? Is this metabolic pathway is catabolic or anabolic? How many genes are regulated by lac Operon? What binds to the operator when lactose levels are low? What happens when lactose levels are high?
Strain ROFL4 has a premature stop mutation in the lacZ gene, resulting in a nonfunctional b-galactosidase. Otherwise all other parts of the operon are functional. 1. Can strain ROFL4 metabolize lactose if it is present? 2. If lactose is absent, will strain ROFL4 transcribe its lac operon? 3. If lactose is present, will strain ROFL4 transcribe its lac operon?
Strain P77 has a mutation in the lacO that prevents it from being bound by the lacI protein. Otherwise all other parts of the operon are functional. 1. Can strain P77 metabolize lactose if it is present? 2. If lactose is absent, will strain P77 transcribe its lac operon? 3. If lactose is present, will strain P77 transcribe its lac operon?
Explain the process of how the Lactose operon functions in the presence of lactose, glucose, both, and without lactose. Explain the process of how the Tryptophan operon functions in the presence of tryptophan and in the absence of tryptophan. What are the three types of horizontal gene transfer among prokaryotes? How do these three types of horizontal gene transfer work? What are restriction endonucleases, restriction fragments, & explain the general premise behind Recombinant DNA technology. Describe: STR’s, Mitotyping, & SNP’s in relation to DNA profiling What are Transgenic or Genetically Modified Organisms? Provide examples using herbicide tolerance and pest resistance.
Explain how the following conditions will affect the regulation of the operon. (3 pts) Low cAMP levels; E. coli grown in a high lactose medium
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
Figure 5 shows the lac operon structure in Escherichia coli. a) Name structures P, Q and R. b) Name substance S. c) What is the enzyme encoded by gene I. Give its function. d) What will happen if substance S is absent in the medium?
The lactose operon in E. coli comprises two structural genes and three regulatory components.a.State the name of each structural gene and describe its function: b.) State the name of each regulatory component and describe its function
The following shows the genotype of a partial diploid bacterial cell - where one chromosomal region containing the lac operon in E,coli is given, and the other fragment is from a plasmid carrying another lac operon from another source. The two are separated by a slash (/). The possible answers indicate with a ʺ+ʺ or a ʺ-ʺ whether β-galactosidase would be expected to be produced at induced levels under two circumstances: 1) first in the absence of lactose and 2) second in the presence of lactose. (Assume that glucose is not present in the medium.)Genotype F: I+ Oc Z-/ Fʹ I- O+ Z+ KEY:I+ = wild-type repressorI- = mutant repressor (unable to bind to the operator)Is = mutant repressor (insensitive to lactose)O+ = wild-type operatorOc = constitutive operator (insensitive to repressor)
Give all possible genotypes of a lac operon that produces, or fails to produce, β-galactosidase and permease under the following conditions. Do not give partial-diploid genotypes. Lactose absent Lactose present β-Galactosidase Permease β-Galactosidase Permease a. − − + + b. − − − + c. − − + − d. + + + + e. − − − − f. + − + − g. − + − +