1. Complete the following table based on your lac operon simulations. Absence of lactose Presence of lactose B-galactosidase permease B-galactosidase permease I'P*O*Z*Y* I'P*0Z*Y* - Mututed ISP+O*ZY* I'P*OʻZ*Y* I*P*O°ZY

1. Complete the following table based on your lac operon simulations. Absence of lactose Presence of lactose B-galactosidase permease B-galactosidase permease I'POZY I'P0ZY* - Mututed ISP+OZY I'POʻZY* IPO°ZY

Name: 1. Complete the following table based on your lac operon simulations.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. Complete the following table based on your lac operon simulations.Absence of lactosePresence of lactoseB-galactosidasepermeaseB-galactosidasepermeaseI*P*O*Z*Y*MututedISP+O*ZY*I'P*O°Z*Y*I*P*O°ZY

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 1VCQ: Figure 16.5 In E. coli, the tip operon is on by default, while the lac operon is off. Why do you...

See similar textbooks

Similar questions

1. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from the following answers. i- p+ o+ z+ y- a+ / i+ p+ oc z- y- a+ Answer choices UII UIC UUU ICC CUC IUC CCU 2. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from the following answers. i- p+ o+ z- y+ a+ / iS p+ o+ z- y+ a+ Answer choices ICC CCU UII IUC UIC CUC UUU
1. What is the default state of the lac operon? a. LacI repressor is sitting on the operator sequence and blocks RNAP from transcribing lacZYA. b. LacI repressor is not in a correct shape to bind to the operator sequence. c. LacI repressor is not produced in the absence of lactose. d. Allolactose is sitting on the operator sequence and blocks RNAP from transcribing lacZYA.
Figure 5 shows the lac operon structure in Escherichia coli. a) Name structures P, Q and R. b) Name substance S. c) What is the enzyme encoded by gene I. Give its function. d) What will happen if substance S is absent in the medium?
1) A. What is the difference between a repressible vs, an inducible operon? B. Using diagrams and words, describe how the Lac Operon is regulated by different levels of lactose and glucose. Be sure to show what’s happening at the molecular level, including the roles of lactose, glucose the repressor protein, cAMP and CAP.
Which of the following lac operon genotypes would allow for functional versions of all the structural enzymes of the lac operon to be expressed constitutively even in the absence of lactose? Group of answer choices I+ O+ Z+ Y+ A+ I- O+ Z- Y- A- I+ OC Z+ Y+ A+ IS O+ Z+ Y+ A+ I+ O+ Z- Y+ A+
Give all possible genotypes of a lac operon that produces, or fails to produce, β-galactosidase and permease under the following conditions. Do not give partial-diploid genotypes. Lactose absent Lactose present β-Galactosidase Permease β-Galactosidase Permease a. − − + + b. − − − + c. − − + − d. + + + + e. − − − − f. + − + − g. − + − +
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
Under which of the following conditions would a lac operon produce the greatest amount of β-galactosidase? The least? Explain your reasoning. Lactose present Glucose present Condition 1 Yes No Condition 2 No Yes Condition 3 Yes Yes Condition 4 No No
Given the following genotypes, explain, by answering the questions in each number, how the mutation (identified by a (-) superscript) will affect E. coli grown in lactose medium. Will there be a complete set ofgene products? (Yes/No) Will the lac operon be turnedon/off? Will the cell survive? (Yes/No) a. i + p + o + z - y + b. i + p - o + z + y + c. i + p + o - z + y +
You are growing E. coli in a laboratory in order to study their operons. The growth media you are using contains lactose, no glucose and no tryptophan. Using your knowledge of operons and their regulation, answer the following questions I really need a in depth epxplantion for the queshtions to make sure i understand the answers a.What effect does lactose have on the bacterial cell’s lac operon? b.What does the absence of glucose do to the bacterial cell? c.You now add tryptophan to the cell. What would happen to the bacterial cell and its trp operon? d.What kind of regulation does lactose provide to an operon’s repressor?
There is Hyaluronic acid synthesis occuring in Group X Strep and it is controlled by an operon with 3 genes, called hasXYZ. Based on the 3-line diagram model, a. How many ribosome binding sites are there for the protein? b. How many promoters are there for the genes? c. How many start codons are there for the protein? d. How many RNA Polymerase binding locations are there for the genes? e. How many proteins will be fully functional? f. How many mRNA strands are made?
Choose correct option and do explain plz. 1. The protein complex that helps RNA polymerase to cross nucleosomes during extension is:a. SWI-SNFb. poly A polymerasac. TFIISd. FACT 2. The polydenylation is carried out by:a. primaseb. polymers poly ac. a reverse transcriptased. adenylyltransferase 3. The lactose operon produces a polycistronic mRNA that includes four genes: Lacl, LacZ, LacY and LacA. True or false?