1) Write down the EC codes for Trypsin and Arginase enzymes. 2) For the conversion of Trypsinogen into Trypsin, how many amino acids should be cleaved and from which site? Write down the sequence of these amino acids.

Q: Create a diagram showing the process of how to make Salivary Amylase.  the diagram can be generic to…

A: Enzymes are special proteins which act as biological catalysts, which are required for the plethora…

Q: A) Discuss how proteolytic cleavage is used to achieve tight control of the activity of digestive…

A: Proteolytic activation is the activation of an enzyme by peptide cleavage. The enzyme is initially…

Q: Briefly (list in bullet points) what are the FIVE stages of Protein synthesis. Why do you suppose…

A:

Q: My textbook says:"Protein encoding genes control protein production indirectly, using a related…

A: Proteins are made of structural building blocks called as amino acids and are found in all cells and…

Q: one experimentally confirm agglutination is due to the binding of the lectins to sialic acid.

A: Agglutination: It is defined as the formation of cells clumps by specific antibodies to antigen…

Q: Which amino acid is predominantly used to add an NH2 moiety during the de novo biosynthesis of…

A: Denovo synthesis of Nucleotides referes to the process of Synthesis of nucleotides from simple…

Q: that turns glutamine into

A: Glutamine and arginine are both non essential amino acid. Mutations are abrupt changes in DNA that…

Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…

A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.

Q: How do guanine and adenine nucleotides inhibit their own synthesis? How do they promote synthesis of…

A: Purine metabolism refers to the metabolic pathways to synthesize and break down purines that are…

Q: Write the names of serine proteases?

A: Proteases are the enzymes that cleaves proteins . Types of proteases are :-  Serine proteases…

Q: 18. peptidiase complete the digestion of peptides to amino acids

A: 18. Proteins are polymers of amino acid. 19. Starch consist of two polysaccharide components- water…

Q: What are the names that we use to distinguish between the two strands of DNA with regards to the…

A: DNA is a double helical structure which had two strands that run in Antiparallel direction.  This…

Q: What is the substrate for RNA synthesis? How is this substrate modified and joined together to…

A: RNA is known as Ribonucleic acid.

Q: I read that vinyl chloride exposure is associated with an increased risk of a rare form of liver…

A: Cancer is the condition of uncontrolled cell division.

Q: b) what is the possible cause of this discase?

A: A tiny tumour in the pancreas that produces too much insulin is known as an insulinoma. The growth…

Q: Imagine that a mutation in the gene encoding the cholera toxin was made. This mutation affects the…

A: Intestinal epithelial cells line the outer layer of gastrointestinal epithelium, they are…

Q: Outline the steps of post-translational sorting of proteins tomitochondria.

A: Mitochondria are one of the most important organelles of a cell. These cells are essential to the…

Q: Why do children need comparatively significant quantities of amino acids like arginine and…

A: Amino acids are a monomers of the polypeptide chain, and they are known to conduct a variety of…

Q: What is the production of RNA called and what is the enzyme that catalyzes the process?

A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…

Q: what is the the function of the protein related to KGD1

A: KGD1 is referred to as the mitochondrial alpha ketoglutarate's subunit. It is a very important…

Q: A. Predict the fragments that will be generated from the treatment of the following peptide with:…

A: Proteases are enzymes that bring about the cleavage of proteins into oligopeptides or individual…

Q: Describe how the absence of the RNA polymerase enzyme affects the proce

A: Introduction: The absence of the RNA polymerase enzyme has an effect on transcription. It is the…

Q: Which of the following statements regarding O-linked glycosylation is FALSE?   A. It occurs on…

A: O linked glycosylation is the attachment of a sugar molecule to the oxygen atom of serine or…

Q: name one kind of mutation that produces an altered protein. what determines wether the altered…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were…

A: Enzymes can catalyze several reactions and aid in speeding up a reaction. There are several enzymes…

Q: Define the following terms: a. PABP b. lipophilic modification c. methylation d. Kozak sequence e.…

A: mRNA in eukaryotes have polyA tails, which are bound by several regulatory proteins. Proteins in…

Q: image, to determine the codons used to code for each amino acid indicated by a number.   For each…

A: The wobble position of a codon refers to the 3rd nucleotide in a codon. At the time of protein…

Q: Pol II is active when its tail is phosphorylated. Which of the following amino acids is present in…

A: Amino acids are biomolecules that are comprised of two functional groups, these are an amino group…

Q: Identify the amino acid for which the codon GAG codes, and what other codon could encode for this…

A: Amino acids are coded from the mRNA sequence, which posses long specific codons. These codons are a…

Q: Define the following terms: a. proteasome b. ubiquitination c. ubiquitin-conjugating system d.…

A: Molecular biology is the branch of science that deals with different molecules inside the body which…

Q: Match the following protein pair with whther they are orthologues, paralogues or neither.…

A: Homologous genes are those gene that share a common evolutionary ancestor. A pair of homologous…

Q: What is the exact function of loop of henle.

A: Nephron is the microscopic structural and functional unit of the kidney. It is composed of a renal…

Q: components that are part of the synthesis of T3 T4?

A: Thyroid hormones are produced by thyroid glands which consists of thyroid follicles serving both as…

Q: A C AAA|A|AC|C GACC |G| |ATC B Ix D E Y F -methionine lysine phenyl- alanine leucine alanine głycine…

A: CENTRAL DOGMA-   Replication is the process when DNA replicates itself means it will make copies of…

Q: How many different types of mutations can result in lactase persistence and what are their names?

A: The functional activity of the Lactase enzyme even in adulthood is termed as Lacatse persistence,…

Q: Define about ubiquitin ligases ?

A: Enzymes have a role in catalysing the many metabolising activities in the human body. Enzymes are…

Q: If mRNA can be blocked, what would the consequences be? what applications could this be useful when…

A: Three types of RNA interact to synthesize proteins namely, mRNA, tRNA, and rRNA. Among these, mRNA…

Q: How does cleavage of a single peptide bond activate the zymogen?

A: Zymogen, is called proenzyme, with no catalytic activity. However, they are transformed into…

Q: Explain the steps involved in translocation of sucrose.

A: Xylem and phloem are the vascular tissues present in the vascular plants.

Q: Write the decarboxylation process for: a) serine, b) histidine, c) tryptophan.

A: Amino acids are biomolecules with a central carbon atom attached to an amine, carboxyl, and an R…

Q: Please determine the order of aminoacids from a given genetic code? 5’-UGGUACGGUACUCCAC-3’

A: Transcription is the process in which the information present on the DNA is transferred on to a…

Q: Which two amino acids may be encoded in genes by stop codons? OA. L-Hydroxyproline and…

A: The genetic code is universal and every individual amino acid is coded by a triplet codon. The…

Q: Two possible point mutations are the substitution of lysine for leucine or the substitution of…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: What is meant by the differential activation of genes? Explain how this affects the synthesis of…

A: Genes are the basic structural and functional units of heredity. They play a major role in carrying…

Q: Give examples of the different classes of mutations that affect the base sequence of DNA in protein…

A: Mutations are well stated to define that they are used to refer to changes or alterations that occur…

Q: SH NH2 NH2 но NH2 C. H,N

A: Peptides or proteins are composed of twenty standard amino acids. These twenty standard amino acids…

Q: Define the following terms: a. proteolytic cleavage b. proproteins c. preproproteins d.…

A: Introduction- Protein is an essential micronutrient for the body as they help in building muscle…

Q: Hi, can you please explain the clinical significance of G protein mutations.

A: Introduction:- G proteins control transcription, motility, contractility, and secretion, which in…