1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the anticodon in tRNA is CUU, what is the complementary codon?3. How many synonyms code for arginine? 4. How many codons code for the amino acid cysteine? 5. How many codons code for the amino acid histidine?6. How many codons code for the amino acid threonine? 1st baseAGUUU PhenylalanineUCUSerineUAU TyrosineUGUCysteineUUC PhenylalanineUCCSerineUACTyrosineUGCCysteineUUALeucineUCASerineUAAStopStopUGG TryptophanUGAAUUG LeucineUCGSerineUAGStopGCUULeucineCCUProlineCAUHistidineCGUArginineCUCLeucineCCProlineСАСHistidineCGCArginineProlineGlutamineArginineCGG ArginineCUALeucineСАСААCGAACUG LeucineCCGProlineCAGGlutamineAUU IsoleucineACUThreonineAAUAsparagineAGUSerineAUC IsoleucineACCThreonineAACAsparagineAGC SerineAAUAIsoleucineACAThreonineAAALysineAGA ArginineAAUG Methionine (Start)ACGThreonine AAG LysineAGG ArginineGUU ValineAlanineAspartic AcidGlycineGGC GlycineGGA GlycineGGG GlycineGCUGAUGGUGUC ValineGCCAlanineAspartic AcidGlutamic AcidGACGGUAValineGCAAlanineGAAAGUG ValineGCGAlanineGAGGlutamic AcidNonpolar, aliphatic Polar, unchargedAromaticPositively chargedNegatively charged2nd base3rd bsae

Since it is a multipart question we are supposed to answer only the first three questions as per the…

1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the anticodon in tRNA is CUU, what is the complementary codon? 3. How many synonyms code for arginine? 4. How many codons code for the amino acid cysteine? 5. How many codons code for the amino acid histidine? 6. How many codons code for the amino acid threonine?

1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the anticodon in tRNA is CUU, what is the complementary codon? 3. How many synonyms code for arginine? 4. How many codons code for the amino acid cysteine? 5. How many codons code for the amino acid histidine? 6. How many codons code for the amino acid threonine?

Aquaculture Science

3rd Edition

ISBN:9781133558347

Author:Parker

Publisher:Parker

Chapter4: Management Practices For Finfish

Section: Chapter Questions

Problem 23SA

See similar textbooks

Similar questions

Identify the polar amino acids, the aromatic amino acids,and the sulfur-containing amino acids, given a peptide with thefollowing amino acid sequence:Val-Met-Ser-Ile-Phe-Arg-Cys-Tyr-Leu
Which peptide would absorb the most UV light at 280nm? (Can you show work because I mainly want to know how to solve this type of problem. Thank you!)Leu-Trp-Tyr-Ala Tyr-Lys-Tyr-Cys Glu-Tyr-Ile-Arg Ala-Trp-Trp-Ala Thr-Ala-Ile-Thr
Write the chemical structure of peptide containing the following amino acid PRO-SER-GLY-LEU I NEED IT ASAP PLEASE
Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr
Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr - do it on this format
How many amino acids (aa) does your protein have? 1,106 aa 551 aa 1,367aa 508aa 1,210 aa Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…
Drew the peptide sequence and write its full name Cys-Gln-Lys-His-Ala-Ser-Gln
Give the amino acid sequence with some little explanation please. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′
Show where trypsin and chymotrypsin would cleave the following peptide Tyr-Ile-Gin-Arg-Leu-Gly-Phe-Lys-Asn-Trp-Phe-Gly-Ala-Lys-Gly-Gin Gin
Which method of chromatography would be the most appropriate for separating mixtures of thefollowing peptides at a neutral pH? (a) ARDDEKLLML, LMYWWILLDETSARALIV, DQNNA(b) GATSKKIVLM, ASCILLVMEN, MFDDAAYVNE(c) KLMDAATSPFLMAGHHHHHH, MFPSATEKRQQNNESTVLAG In what order would the following peptides be eluted from an anion exchange column at pH 7.5?Peptide 1: Ala–Asp–Glu–Gln–Trp–Leu–His–ValPeptide 3: Phe–Gln–Glu–Ala–Gln–His–Leu–Arg-IlePeptide 2: Arg–Ile–Pro–Lys–Cys–Met–Lys
why is CH3-CH-CH2-CH2-CH3 non imposable ? I OH
The sequence of the peptide is: a. AINRFILAC b. MGILYRNLG c. MAILYNRLA d. CALIFRNIA e. CALIRYNIA