Answered: 4)Which of the following have codons?…

4)Which of the following have codons? Choose all that apply DNA RNA polymerase proteins tRNA mRNA amino acids None of these rRNA acetyl transferase

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 8SQ

See similar textbooks

Related questions

Q: According to the central dogma, what molecule should go in the blank? DNA → _____ → Proteins…

A: DNA's full form is deoxyribonucleic acid. It is the genetic material of the organisms that transfer…

Q: the sequence of a DNA template is 17. What is the sequence of the mRNA that will result from the…

A: Transcription is the process by which RNA is synthesized with the help of DNA. Abrupt changes in the…

Q: The new DNA codon would be GAT. This would code for the mRNA codon CUA, which would translate into…

A: Introduction DNA:- It is the hereditary material in humans and almost all other organisms, Your…

Q: What genetic material in a living cell which is single stranded involved in the coding of genes for…

A: The flow of information in cells takes place from transcription to translation. The translation is…

Q: 70. Which of the following codes for the stop codon in mRNA? A.UUC B.UGA C.AUG D.AAA

A: Answer B) UGA

Q: After transcription, how is mRNA processed in eukaryotes? (Choose all that apply) 3' polyA tail is…

A: TRANSCRIPTION It is the formation of mRNA from DNA. The mRNA formed has to undergo various…

Q: EF-tu binds to the 3'end of charged tRNAs can only bind a charged tRNA when it is…

Q: A certain mRNA strand has the following nucleotide sequence: 5'—AUG—ACG—UAU—AAC—UUU—3' What is the…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: Which of the following mutations would be more detrimental to an organism? 1) a mutation that…

A: Mutations are the alterations in the DNA that can happen either due to internal factors like…

Q: During Codon recognition (a) the ribosome moves towards the 3’ end of the mRNA (b) a tautomeric…

A: A codon is the three-nucleotide stretch of sequence which codes for proteins. In central dogma, it…

Q: Which molecules are required during Translation? Choose ALL that apply Select all that apply:…

A: In biology & genetics, translation is defined as the interaction wherein ribosomes in the…

Q: Consider this list (below) of steps involved in translation. These steps are out of order.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…

Q: Which of the following molecules are participate in the steps protein synthesis steps in both the…

A: Introduction :- RNA polymerase creates RNA by following a DNA strand. RNA polymerase is an enzyme…

Q: The wobble position of a codon can sometimes vary without changing the amino acid. is where RNA…

A: Introduction The third base of the codon is called as wobble position of a codon. tRNA is the…

Q: 120. What is the nature of the molecule coded by each codon(triplet code) of mRNA? A.Peptide bond…

A: Triplet code is a three amino acid each codon (within the code), consists of three, nonoverlapping…

Q: Which of these molecules is responsible for bringing the correct amino acid to the ribosome? acetyl…

A: Translation is the process by which the cells of the body prepare their own proteins in the…

Q: A tRNA anticodon is 5ʹ GCU 3ʹ. What codon can it bind to and what amino acid should it carry?…

A: DNA -> Transcription -> mRNA -> Translation -> Protein Transcription is the synthesizes…

Q: Fill in the following information for making the following polypeptide (the codon chart is below).…

A: The sequence of nucleotides in DNA or RNA makes up the genetic code. Codons are three-base groups…

Q: What are ribosomes composed of? tRNA & proteins mRNA & tRNA rRNA & proteins mRNA & proteins…

A: The ribosomes are composed of two subunits a smaller and a larger and the sizes of prokaryotic and…

Q: Which nucleic acid has a double helix structure? tRNA mRNA rRNA DNA

A: Nucleic acids that are present in the environment can be of two different types based on the type of…

Q: Which of the following are involved in translation? Choose all that apply tRNA DNA ribosome…

A: The correct answer is t RNA, Ribosome, Amino acid, mRNA, rRNA

Q: Which of the following base pairings are allowed between an anticodon and the 3' base of a codon,…

A: According to wobble hypothesis, the third nucleotide of anticodon is a wobble and can base pair with…

Q: The coding strand of DNA in a segment of a gene is as follows: ATG GGC CTT AGC. This strand carries…

A: The DNA (deoxyribonucleic acid) duplex consists of a non-template and a template strand. The…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: 1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the…

A: Since it is a multipart question we are supposed to answer only the first three questions as per the…

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: 1)Which of these molecules is responsible for bringing the correct amino acid to the ribosome? RNA…

A: Translation is the process by which proteins are synthesized using ribosomes. It takes place in the…

Q: Look carefully at the illustrations for gene translation. What mRNA codon specifies the tRNA…

A: As the illustration for the gene translation is not given. we are providing all the possible codons.

Q: 3)Which of the following are involved in translation? Choose all that apply ribosome tRNA amino…

A: Answer- Involved in translation are :- ribosome tRNA mRNA rRNA amino acids

Q: The exons and introns of a gene are shown below. Introns are shown as black bars. Exons are numbered…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: What does it mean when we say the genetic code is redundant? a) A single codon can specify…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: Which of the following is INCORRECT? The genetic code is contained in 20 different codons. All…

A: The genetic code is a set of rules that living cells use to convert information found in genetic…

Q: True or False Process of translation 1. transfer RNA is made from messenger RNA 2. tRNA uses…

A: Translation: The process of translation involves the synthesis of a protein or a polypeptide inside…

Q: How many initiation codons are there? a. 1 b. 3 c. 4 d. 20

A: Genetic codon or triplet codon basically serves the function of protein translation. Ribosomes are…

Q: Frameshift mutation _____________________ Select one: can result in a completely new codon sequence…

A: These mutations include insertions or deletions in between the nucleotide sequence of the genome,…

Q: The nucleotide triplet AAA is the codon for Lysine. This codon originated from the following piece…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Which of the following help(s) to stabilize mRNA by inhibiting degradation? a. Introns b.…

Q: Drag and drop the following terms into the correct spots on the image below. 1. Amino Acids 2.…

A: Ribosomes are responsible for the production of proteins. They accomplish this through a process…

Q: result

A: Transition mutation is nothing but the replacement of one purine nucleotide with other and one…

Q: There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs. This is best explained by…

A: Answer: Introduction: The mRNA codons are read while translation, starting with a start codon and…

Q: Which of the following codons is called the start codon? a.UAA b.UGA c.UAG d.AUG

A: The connection between the series of nucleotide on mRNA and series of amino acid in the polypeptide…

Q: 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: The figure below shows a ribosome in the process of translating an mRNA with a sequence:…

A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…

Q: A particular triplet of bases in the coding sequence of DNA is AAA. The anticodon on the tRNA that…

A: If the template strand of DNA has AAA, it will be transcribed to mRNA as UUU. A tRNA that would…

Q: 10. During elongation of a peptide chain, which site in the ribosome represents the location where…

A: Translation is the process of the formation of polypeptide chains of amino acids that lead to the…

Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…

A: The given DNA sequence is as follows, TGC GTG TAC CTA CCA

Q: Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: When the ribosome reaches a nonsense codon, which of the following occurs? a methionine is…

A: Ribosomes are translational machinery utilized during the synthesis of proteins. It is a complex of…

Q: 3. Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart in…

A: Question 3 A) TAC CTA GCG CAC ATG TAG GTG GGC AAA GTT m-RNA sequence: AUG GAU CGC GUG UAC AUC CAC…

Q: )Which of the following statements are true? Choose all that apply a)There are multiple codons…

A: The DNA expression involves the protein synthesis which involves a series of events primarily the…

Question

4)Which of the following have codons? Choose all that apply

DNA

RNA polymerase

proteins

tRNA

mRNA

amino acids

None of these

rRNA

acetyl transferase

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Explain The mRNA codon of valine is: GUC UGG CCA TTG
From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU asap
PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONS
AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acids
From the picture provided, which colored option (exon variant) will give me: 1. start codon 2. Stop codon Im not sure how to identify with exon out of the 15 exon varients provided which one has the start codon and which has the stop I need to filter these colored options in order to find my start codon and stop codon
The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the Shine–Dalgarno sequence and the initiator codon.5′¬CUACCAGGAGCAAAGCUAAUGGCUUUA¬3′
1e) Give the sequence of every codon this tRNA, with the anticodon 5'AGG3', could base pair with (perfect and wobble matches), and name the amino acid coded for by each codon whose sequence you have written.
How do I determine the eventual amino acid code from: 3' TACCCCGGGTTTCAACATG 5' -(TEMPLATE STRAND) 5' ATGGGGCCCAAGTTGTAC 3' -(CODING STRAND)
I’m supposed to translate tRNA into amino acids for each codon of the previous question and state what the amino acid chains become. For example: AUG AAA CGC CCA....
1c) Give the anticodon of the tRNA that would be a "wobble match" for the codon 5'AGG3'.
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table