Q: 3. An alteration of genetic information is shown below. A-G-T-A-C-C-G-A-T → A-G-T-G-A-T What type of…
A: Alteration of genetic information shown below is an example of Deletion Mutation. In the given…
Q: 1. Which one of these indicated groups or bonds: hydroxyl; phosphate; triphosphate; nitrogen base;…
A: DNA replication is a mechanism that involves breaking and building bonds. Replication occurs in 3…
Q: Which one of the following statements is true? Select one: O a. It takes three genes to code for one…
A: Gene can be defined as the segment of DNA. It contains information about the genetic characteristic…
Q: 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'
A: DNA sequencing is the biochemical method used for determining the order of nucleotide bases, A, G,…
Q: 2. Another kind of mutation is the so-called frameshift mutation, caused by an insertion or a…
A: Frame shift mutation occurring due to insertion or deletion of single nucleotide will lead to shift…
Q: 1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of…
A: Defination of the gene :-
Q: 1. Which of the following rules apply to the synthesis of nucleic acids? A. Nucleotides are added to…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: List the amino acid sequence of the protein coded for.…
A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…
Q: 1. Explain why the primary structure sequence -Lys-Leu-Trp-Asp- may promote a-helix formation while…
A: The formation of α helix is occurred due to attachment of H of N of Cα of first (n) amino acid to…
Q: 1.Which of the following RNA has a catalytic activity like an enzyme? A. MRNA C. FRNA B. tRNA D.…
A: 1. (C) rRNA 2. (A) deoxythymidine 5'-monophosphate 3. (B) they differ in pitch
Q: 6. Two possible paint mutations are the substitution of lysine for leucine or the substitution of…
A: Every physiological characteristic or metabolism of our body mainly controlled by proteins. These…
Q: 1. Based on the results obtained give the differences between the hydrolyzed and unhydrolyzed RNA.
A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…
Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…
A: Sickle cell anaemia is an autosomal recessive disorder.
Q: 1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: The genetic code is a set of three-letter combinations of nucleotides that corresponds to a specific…
Q: 7. Give all the possible Anti-codons for the amino acids listed below. Histidine (His) Isoleucine…
A: Codons is a sequence of three nucleotides that corresponds with a specific amino acid or stop signal…
Q: 1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle…
A: 1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle…
Q: 2. The types of intramolecular bonds in nucleic acid include the following EXCEPT: A. Hydrogen Bond…
A: Nucleic acids are made up of different nucleotides. Nucleotides are composed of nitrogenous base,…
Q: 1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the…
A: Since it is a multipart question we are supposed to answer only the first three questions as per the…
Q: 4. The sequence of base triplets on the coding strand DNA molecule is TGACCGTTAGCG. Which of the…
A: The genetic code is sometimes referred to as a "blueprint" since it provides the instructions that a…
Q: The bisulfite sequencing is different from regular sanger sequencing of nucleotides because…
A: The Sanger sequencing is also known as the chain termination method, it is a method used to…
Q: Which of the following most accurately describes the anticodon? A. Contains a sequence…
A: Anticodon The base sequence of tRNA which pairs with codon of mRNA during translation is called…
Q: We often think only of DNA and RNA as nucleic acids. Discuss the role of other, less “well-known”…
A: 1. The role of cAMP is used for intracellular signal transduction , such as transferring into cells…
Q: Transcribe the following DNA sequence into codons.…
A: Transcription is a process in which there is formation of messenger RNA from the DNA template In…
Q: 5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a…
A: Charged tRNA match an mRNA codon with the amino acid it codes. tRNA brings amino acids to…
Q: Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the…
A: Sickle-cell anemia is a genetic disease characterized by the sickle shape of the RBCs. It results in…
Q: 2. Describe the process that is occurring in this image protein nibosome
A: The proteins are the final product of a gene that perform all the functions within the cell.…
Q: 1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell…
A: * Sickle cell anemia is blood disorder in which red blood cells becomes mis shapen and turns into…
Q: 3. Which of the following represents a similarity between RNA and DNA? A. The presence of Uracil…
A: DNA and RNA are both very essential biopolymers that sustain life. It is present in all forms of…
Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG
A: Biological macromolecules are those that are made up of large molecules in order to carry out normal…
Q: 4. Sickle cell anemia occurs due to a point mutation in a gene for hemoglobin protein. This mutation…
A: Introduction : In sickle cell anemia, there is single nucleotide change within the gene. Thymine…
Q: a) The genetic code in unambigous that means many codons can code for the same amino acids. b)…
A: 1. The genetic code is UNAMBIGUOUS:- Means that each triplet specifies only a single amino acid.…
Q: 5. The genetic evidence for a triple code (three nucleotides are responsible- for one amino acid)…
A: The proteins are produced from the mRNA by the translation process. This function is performed by…
Q: 1. Below is a sequence of DNA bases. =T ACTTCACG AGTGAGACT a) Transcribe to MRNA: AUGAAGUGCUCACUCUGA…
A: Transcription is a process in which the DNA sequence is converted to mRNA. In mRMA there is Uracil…
Q: 2. Decode the hidden message from the polypeptide coded by the DNA sequence below. Express the amino…
A: The given sequence can be read by combining sets of three nucleotides per amino acids.
Q: 4)Which of the following have codons? Choose all that apply DNA RNA polymerase proteins tRNA…
A: Codons are the set of three nucleotides which encode a particular amino acid.
Q: Match each nucleobase to its corresponding pair. 1. pairs with cytosine 2. pairs with guanine 3.…
A: Given: Nucleic acids are the polymers of nucleotides.Nucleic acids are the macromolecules found in…
Q: ______________________________________________________________ 1. People who carry a theoretical…
A: Restriction fragment length polymorphism or RFLP is the easiest way to detect the presence of SNPs…
Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…
Q: 1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation…
A: Any detectable, inheritable, qualitative or quantitative change in genetic material of an organism…
Q: Discuss the difference between intron and Exon
A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…
Q: 7. Guanidinium group is associated with: a. Tyrosine b. Arginine c. Histidine d. Lysine e.…
A: Amino acids are building blocks of protein and amino acids are composed of an amino group, carboxyl…
Q: 1.What are nucleic acids? What are their functions? 2.Illustrate and compare the primary and…
A: Nucleic acids are one of the biomolecules that are important for the carrying of genetic information…
Q: Regarding the triple DNA code, which of the following statements is true?
A: The genetic code refers to the set of rules that all living organisms use to encode information,…
Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…
A:
Q: 1) The direction of transfer of genetic information in all living things (as defined in the central…
A: it is the process of conversion of the DNA into the functional product it explains how genetic…
Q: )Which of the following statements are true? Choose all that apply a)There are multiple codons…
A: The DNA expression involves the protein synthesis which involves a series of events primarily the…
Q: 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC 5' a. What amino acids are…
A: Non sense codons are stop codons which lead to termination of translation. These are - UAA, UAG,…
Q: 8. Complete the following table. Remember to label the 3' and 5' ends of all polynucleotides. Assume…
A:
1.Write a DNA sequence that would encode the amino acid sequence valyl-tryptophanyl-lysyl-prolyl-phenylalanyl-threonine.
Step by step
Solved in 2 steps
- 1. What are congenital disorders of glycosylation (CDGs)?1. Why does a cell use deoxyribonuclease?1. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. ATG GCA TGC AAT AGC TCA TGC 2. What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A?
- Pyrimidines built from a single carbon ring are: a. cytosine and thymine. b. adenine, cytosine, and guanine. c. adenine and thymine. d. cytosine and guanine. e. adenine and guanine.3. List the amino acid sequence of the protein coded for. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .1. What determines the affinity of a glycan for a GBP?
- 1.One of the main sources of sphingosine in the body is in the cell membrane. What complication could arise from the biological synthesis of ceramide?The nucleoside consists of a D-deoxyribose and a cytosine base is called ______. A. cytidineB. deoxycytidineC. deoxycytidylateD. deoxyribosylcytosine E. deoxyribosylcytidine1. A tRNA to which the correct amino acid has been attached is called?