TRUE/ FALSE STATEMENTS WITH EXPLANATION 1. Restriction enzymes can occasionally cut at site(s)other than its restriction site.2. DNA ligase is used to form hydrogen bond betweencomplementary strands.3. DNA fragments obtain from genomic library isgenerally shorter than those from CDNAlibrary.4. PCR can still initiate without the presence ofprimers.5. Conformers uses energy to regulate their bodytemperature.6. All blood capillaries in the body will dilate in the bodytemperature exceed optimum temperaturelevel.7. Endotherms gain heat from environments.8. Juxtamedullary nephrons have a shorter Loop of Henlecompared to cortical nephrons.9. Podocytes is the main filtration barrier inultrafiltation.10. More of mitochondria reside near basal channel toaid in its reabsorption adaptation in proximal tubulecell.

NOTE:- As you have posted multiple questions, we will solve first two parts for you, To get the…

Answered: 1. Restriction enzymes can occasionally…

1. Restriction enzymes can occasionally cut at site(s) other than its restriction site. 2. DNA ligase is used to form hydrogen bond between complementary strands.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 2TYK

See similar textbooks

Related questions

Q: purpose(s) of DNA extraction

A: The purpose of DNA extraction are: To study the genetic cause of the disease. For the development…

Q: Draw an Illustration of the steps in restriction digestion and PCR [ Please make it clean and…

A: Restriction digestion is the process of cutting the DNA sequence at a particular nucleotide sequence…

Q: 3. What is a restriction digest? What does it mean if you were given a precut DNA? 4. What is…

A: Restriction digest It is the process of cutting DNA molecules into smaller pieces with special…

Q: 2. What is the function of each of the replication enzymes listed below? a. DNA polymerase III b.…

A: The DNA replicates itself multiple times during the replication process. It is a biological…

Q: 33 - The correct procedures for gene cloning are given as a) PCR/transformation/ligation/restriction…

A: Gene cloning is the method of production of numerous copies of a gene fragment.

Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…

A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…

Q: 1 Restriction enzymes cut DNA molecules atspecific locations to produce restriction fragments…

A: Restriction enzymes refer to the enzymes that generate fragments of DNA (deoxyribonucleic acid)…

Q: 1. How may recombinant DNA molecules be introduced into human cells? a. by splicing the needed…

A: As per the guidelines, we are supposed to answer only one question. Kindly repost the other question…

Q: 1. What is the function of the electrophoresis buffer? 2. Why did you mix your samples with loading…

A: Gel electrophoresis: it is a technique used to sepals different fragments of different lengths of a…

Q: ) Base excision repair requires polymerases. B.) In DNA repair by excision, the non-damaged strand…

A: Solution : Correct option is d

Q: 18. An instructor had her students perform this laboratory beginning with setting up their own…

A: Agarose gel electrophoresis is the technique for the separation of DNA fragments on the basis of…

Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…

A: A polymerase is an enzyme that helps to synthesizes long chains of polymers or nucleic acids. It…

Q: DNA cloning isa. making multiple genetically identical cells.b. making multiple copies of a piece of…

A: Molecular biology deals with the molecular basis of the cells including the synthesis,…

Q: 2. Which of these statements is INCORRECT about restriction enzymes Restriction enzymes form…

A: Restriction enzymes originated from bacteria

Q: 1. This image summarizes how computers sort and order DNA fragments to produce a final sequence of…

A: Nucleic acid is chemically different than protein and carbohydrate . This difference helps in…

Q: We have mRNA prepared from human cells but PCR needs DNA. What should we do?

A: A polymerase chain reaction (PCR) is a technique that is used in molecular biology to amplify a…

Q: Modern researchers can manipulate genetic material to alter genes and blend plant, animal and…

A: Genetic engineering: Also called genetic modification, it is defined as the process in which the DNA…

Q: . Illustrate the basic steps in DNA extraction

A: The genetic material that is densely packed inside the nucleus and chromosomes is known as DNA. The…

Q: Which enzyme is used in Sanger sequencing reactions? O A. DNA polymerase O B. S1 endonuclease O C.…

A: Introduction :- Sanger DNA sequencing is commonly employed in research to target smaller genomic…

Q: 1. You are a research assistant in a renowned science academy. Your supervisor requires you to…

A: PCR:- it is used to amplify the fragments of a DNA or gene of interest. Gene cloning:- it is a…

Q: E) double stranded DNA separates into single stranded DNA

A: The correct option is E . Double stranded DNA separates into Single stranded DNA .

Q: 1. What does PCR stand for? 2. Explain the main objective of the PCR technique.

A: PCR It is a technique used in molecular biology which was developed by Kary Mullis, an American…

Q: The restriction enzymes used in gene-cloning experiments, which generates sticky ends that can .a.…

A: Deoxyribonucleic acid (DNA) is a long molecule. DNA contains the instructions an organism required…

Q: fa restriction endonuclease recognizes and cleaves a linear piece of DNA and Circular DNA at 8…

A: Restriction endonuclease These are also known as restriction enzymes. These enzymes have been…

Q: _1. Bacterial proteins that have the ability to cut both strands of the DNA molecule at certain…

A: DNA and RNA are the two main forms of nucleic acids. Nucleotides, which have a five-carbon sugar…

Q: 1. This diagram is showing the process of 2. If the original template strand reads: TTACGCAGT, DNA…

A: DNA replication is a process by which DNA makes a copy of itself. It does this by the help of enzyme…

Q: 1. The polymerase chain reaction (PCR) is used by scientists to amplify DNA, particularly when the…

A: We are answering 1st question only. For the rest of the questions please repost. The polymerase…

Q: DNA polymerase III adds nucleotides to both ends of the RNA primer to the 5' end of the RNA primer

A: DNA is the genetic element found in all prokaryotic and eukaryotic cell types. DNA is a…

Q: Which enzyme was used to produce the molecule in the figure above? O ligase O DNA polymerase O RNA…

A: DNA cloning, is a process in which a piece of gene is inserted into the circular piece of DNA…

Q: Give me 3 examples of how PCR and restriction enzymes can be used to create a genetic fingerprint

A: DNA is made of nucleotides, which are composed of a nitrogenous base, deoxysugar, and phosphate. The…

Q: catalyzes the cleavage of DNA at a specific ii fragments. The statement given above is completed…

A: Enzymes are catalysts or the molecule, which are reaction specific. DNA ligase, DNA polymerase,…

Q: The leading strand in DNA replication requires only one primer for its synthesis. The lagging strand…

A: DNA replication is the semi-conservative process in which each strand of DNA molecule act as a…

Q: 1. What is the basis of separation of different DNA fragments by gel electro- phoresis? a. The…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 4. A linear fragment of DNA is exposed to a digest containing the individual restriction enzymes…

A: For doing restriction mapping we need to arrange each fragments at it's proper position. The process…

Q: scientist uses a molecule of DNA composed of radioactive nucleotides as a template for replication…

A: DNA replication is the process of formation of exact duplicate copy of DNA. Transcription RNA is…

Q: • Teil Me Why NA In Vitro: The Poly Re Why did the discovery and development of restriction enzymes…

A: With the advancement of science and technology in the field of life sciences, there has emerged…

Q: 9. Five DNA samples are shown along with their recognition sites where a particular restriction…

A: Gel electrophoresis Gel electrophoresis is a molecular technique that involves the separation of DNA…

Q: Which of the enzymes from the following list wouldyou need to make a recombinant DNA molecule?…

A: The recombinant DNA is where the two or more DNA molecules are integrated into a vector plasmid to…

Q: The extraction of DNA is a common procedure in biotechnology research laboratories. Research the…

A: Common DNA extraction methods Different extraction methods result in different yields and purity of…

Q: 1. produces multiple identical copies of a gene [ Choose ] a. DNA ligase…

A: The structural and functional unit of "heredity" is called a gene. A gene is a segment of DNA that…

Q: Design PCR primers for the DNA sequence given below and explain your choice. As part of your answer,…

A: PCR It is a Polymerase Chain Reaction which is a technique through which a specific fragment of DNA…

Q: If a restriction endonuclease recognizes and cleaves a linear piece of DNA at 5 distinct places, how…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which of the following tools of DNA technology is incorrectlypaired with its use?(A)…

A: As in the recent times, the approach towards genetics has gone up a high level. Various techniques…

Q: What is the purpose of restriction enzyme? 2. What is the purpose of the probe in DNA finger…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: Restriction enzymes in bacterial cytoplasm cut injected bacteriophage DNA wherever certain sequences…

A: Enzymes are the protein which acts as catalyst in the chemical reactions. Enzymes neither takes part…

Q: 30 The name of the small DNA fragment used to determine if the complementary sequence is present in…

A: The name of the small DNA fragment used to determine if the complementary sequence is present in…

Q: 3) Analysis of the sequence of a DNA fragment shows the presence of restriction site for the enzyme…

A: The restriction site is the site which is a type of specific genetic sequence present on the DNA…

Question

TRUE/ FALSE STATEMENTS WITH EXPLANATION

1. Restriction enzymes can occasionally cut at site(s)
other than its restriction site.
2. DNA ligase is used to form hydrogen bond between
complementary strands.
3. DNA fragments obtain from genomic library is
generally shorter than those from CDNA
library.
4. PCR can still initiate without the presence of
primers.
5. Conformers uses energy to regulate their body
temperature.
6. All blood capillaries in the body will dilate in the body
temperature exceed optimum temperature
level.
7. Endotherms gain heat from environments.
8. Juxtamedullary nephrons have a shorter Loop of Henle
compared to cortical nephrons.
9. Podocytes is the main filtration barrier in
ultrafiltation.
10. More of mitochondria reside near basal channel to
aid in its reabsorption adaptation in proximal tubule
cell.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1- Introduction

VIEW

Step 2- Explanation

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In 5 sentences only, What are restriction enzymes (RE)? Describe how a RE can be used to develop/design a DNAmarker.
Explain briefly within 5 sentences each 1. a. What is PCR? Explain/relate its importance in DNA marker analysis. 1.b. What are restriction enzymes (RE)? Describe how a RE can be used to develop/design a DNAmarker.
1. (a) Restriction sites are usually ______. Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences (b) Involves joining a donor DNA fragment of interest to a vector Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences
Draw an Illustration of the steps in restriction digestion and PCR [ Please make it clean and readable, labelled should be included, Drawing ] ( THIS IS ALL ABOUT APPLICATIONS OF RECOMBINANT DNA).
Definition of Terms( This is all about Applications of Recombinant DNA) a. Clone b. Plasmids c. Biotechnology d. PCR Amplification e. Detection f. Modified Trait g. Human Genome h. Genetic Modified Organism
Illustrate the steps in restriction digestion and PCR [ Please make it clean and readable, labelled should be included ] ( THIS IS ALL ABOUT APPLICATIONS OF RECOMBINANT DNA).
Features of restriction enzymes include the following, except __________ . a. They are produced by both prokaryotes and eukaryotesb. may be type IIc. make single and double stranded breaks in DNAd. operate at a single temperaturee. Are used in nature to destroy bacteriophage DNA
Chromosomal DNA fragments for molecular cloning are cut by _________, and inserted into molecular vectors (such as plasmids) using __________. a. Ligase; Restriction Endonucleases. b. Restriction endonucleases; Ligase. c. DNA polymerase 1; Primase. d. DNA polymerase 1; Ligase. e. Primase; Helicase.
Give me 3 examples of how PCR and restriction enzymes can be used to create a genetic fingerprint
PCR can be used______ . a. as a cloning vector b. in DNA profiling c. to modify a human genome
Definition of Terms( This is all about Applications of Recombinant DNA){ 2-3 sentences only) a. Clone b. Plasmids c. Biotechnology a. PCR Amplification b. Detection c. Modified Trait d. Human Genome e. Genetic Modified Organism
A more modern molecular technique to RFLP fingerprinting is called Amplified Fragment Length Polymorphisms (AFLPs). In AFLP analysis, restriction enzymes are again used to digest genomic DNA into multiple fragments. Next, adapters complementary to restriction site overhangs are ligated to the fragments using an enzyme called DNA ligase. These adapters are complementary to primers used to amplify the fragments using the polymerase chain reaction (PCR). Can you think of any potential benefits of AFLP analysis over RFLP? Explain your reasoning.