4. A linear fragment of DNA is exposed to a digest containing theindividual restriction enzymes HindIII and Smal and then witha combination of the two enzymes. According to the gelelectrophoresis results, the fragments obtained areLinear DNA HindIII Smalcut with:DNAHindIII +Smal5.0fragments 2.5(kb)5.53.02.02.52.0a. Draw a map of the restriction sites on this linear piece ofDNA.b. The mixture of fragments produced by the combinedenzymes was then digested with the enzyme EcoRI. Theresults are fragments that are 2.5 kb, 2.0 kb and 1.5 kb. Addthe restriction site for EcoRI on the map you created above.

For doing restriction mapping we need to arrange each fragments at it's proper position. The process…

4. A linear fragment of DNA is exposed to a digest containing the individual restriction enzymes HindIII and SmaI and then with a combination of the two enzymes. According to the gel electrophoresis results, the fragments obtained are Linear DNA HindIII Smal cut with: HindIII + Smal DNA fragments (kb) 5.0 5.5 3.0 2.5 2.0 2.5 2.0 a. Draw a map of the restriction sites on this linear piece of DNA. b. The mixture of fragments produced by the combined enzymes was then digested with the enzyme EcoRI. The results are fragments that are 2.5 kb, 2.0 kb and 1.5 kb. Add the restriction site for EcoRI on the map you created above.

4. A linear fragment of DNA is exposed to a digest containing the individual restriction enzymes HindIII and SmaI and then with a combination of the two enzymes. According to the gel electrophoresis results, the fragments obtained are Linear DNA HindIII Smal cut with: HindIII + Smal DNA fragments (kb) 5.0 5.5 3.0 2.5 2.0 2.5 2.0 a. Draw a map of the restriction sites on this linear piece of DNA. b. The mixture of fragments produced by the combined enzymes was then digested with the enzyme EcoRI. The results are fragments that are 2.5 kb, 2.0 kb and 1.5 kb. Add the restriction site for EcoRI on the map you created above.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 9TYK

See similar textbooks

Similar questions

1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
1) Restriction enzymes come in a concentration of U/ml, and it is recommended that 1U be used for each ug of DNA to be digested. If an enzyme you want to use comes in at 22,000 U/ml, and you want to digest 5 ug of DNA. How much volume will you have to use for the reaction and how will you be able to measure it with the pipettes we have in the lab? 2) An enzyme for ligation (Cip) comes at a concentration of 16000 units/ml. How many units will there be in 10 ul?
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
1) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference. (Word limits: 300) 2) Why was there a greater A260 absorbance reading for your DNA sample that was incubated at higher temperatures. (Word Limits: 100)
1) What happened to the DNA at the different temperatures? How does Polymerase Chain Reaction exploit this property of DNA (Word count: 200) 2) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference
For the given restriction enzyme: BslI (CCNNNNN^NNGG) i) Approximately how many fragments would result from digestion of the human genome (3 × 109 bases) with the enzyme? ii) Estimate the average size of the pieces of the human genome produced by digestion with the enzyme. iii) State whether the fragments of human DNA produced by digestion with the given enzyme would have sticky ends with a 5′ overhang, sticky ends with a 3′ overhang, or blunt ends. iv) If the enzyme produces sticky ends, would all the overhangs on all the ends produced by that enzyme on all fragments of the human genome be identical, or not? The recognition sequence on one strand for the enzyme is given in parentheses, with the 5′ end written at the left. N means any of the four nucleotides; R is any purine—that is, A or G; and Y is any pyrimidine—that is, C or T. ^ marks the site of cleavage. Note that the recognition sites containing Ys and Rs are not always rotationally symmetrical.
ques 1 . A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained: Enzyme Fragment size (kb). EcoRI 1.3, 1.3 Hpall 2.6 HindIII 2.6 EcoRI+Hpall 1.3, 0.8, 0.5 EcoRI + HindIII 0.6, 0.7, 1.3 a. Is the original molecule linear or circular? b. Draw a map of restriction sites, showing distances between sites, that is consistent with the data presented. ques 2. You have double-stranded DNA that you radioactively label at the 5' ends. Digestion of this molecule with either EcoRI or BamHI yields the following fragments. The numbers are in kilobases (kb) and an asterisk Indicates the fragments that are unlabled EcoRI: 2.8, 4:6, 6.2*, 7.4, 8.0* BamHI: 6.0%, 10.0", 13.0 IF unlabeled DNA is digested with both enzymes simultaneously, the fragments 1.0, 2.0, 2.8, 3.6, 6.0, 6.2,7.4. What is the restriction map for the two enzymes?
1. Briefly explain why the total size of the pMBBS plasmid in the Restriction Enzymes practical is 3000bp (base pairs) 2. Briefly explain why the cut sites on the pMBBS plasmid in each Restriction Enzymes (EcoRI, BamHI, and XhoI) just 1 each 3. Briefly explain what led to the 5 fragments formed which linked to the 500bp, 1000bp, 1500bp, 2000bp, 2500bp sizes
For each of the restriction enzymes listed below:(i) Approximately how many restriction fragmentswould result from digestion of the human genome(3 × 109bases) with the enzyme? (ii) Estimate theaverage size of the pieces of the human genomeproduced by digestion with the enzyme. (iii) Statewhether the fragments of human DNA produced bydigestion with the given restriction enzyme wouldhave sticky ends with a 5′ overhang, sticky endswith a 3′ overhang, or blunt ends. (iv) If the enzymeproduces sticky ends, would all the overhangs on allthe ends produced on all fragments of the humangenome with that enzyme be identical, or not? (Therecognition sequence on one strand for each enzymeis given in parentheses, with the 5′ end written atthe left. N means any of the four nucleotides; R is any purine—that is, A or G; and Y is any pyrimidine—that is, C or T. ^ marks the site of cleavage.)a. Sau3A (^GATC)b. BamHI (G^GATCC)c. HpaII (C^CGG)d. SphI (GCATG^C)e. NaeI (GCC^GGC)f. BanI (G^GYRCC)g. BstYI…
1. Explain how the SNP changes the recognition sequence for the restriction enzyme and affects its ability to cut the DNA. Indicate which of the 2 alleles (taster or non-taster) is cut by the restriction enzyme. 2. Predict the size of the expected DNA fragments after restriction digest for the two alternative SNP sequences (the taster and the non-taster).i.) Taster allele after being cut ii.) Non-taster allele after being cut
1. How does PFGE separate larger fragments more efficiently than standard electrophoresis? 2. Why is SYBR green less toxic than EtBr? 3. What are the similarities and differences between Manual and Automated Sanger Sequencing? 4. What is the relationship between DNA fragment length and the distance it will run in a gel? (Restriction Enzyme Digestion)
The 50ul of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading into the gel?