Which of the candidate genes would be good targets to develop potential therapeutics using SİRNA (Hint: you might want to go back and review RNAI interference lecture 10B). For which of these genes is SİRNAI treatment good strategy for cancer therapy. SIRNA is a technique that targets and degrades gene specific RNAS. A) p53 B) cyclin D C) Muts also MSH2/6 D) ras E) let-7 F) telomerase

Which of the candidate genes would be good targets to develop potential therapeutics using SİRNA (Hint: you might want to go back and review RNAI interference lecture 10B). For which of these genes is SİRNAI treatment good strategy for cancer therapy. SIRNA is a technique that targets and degrades gene specific RNAS. A) p53 B) cyclin D C) Muts also MSH2/6 D) ras E) let-7 F) telomerase

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter16: Reproductive Technology, Genetic Testing, And Gene Therapy

Section: Chapter Questions

Problem 13QP: The prospect of using gene therapy to alleviate genetic conditions is still a vision of the future....

See similar textbooks

Similar questions

During the first successful gene therapy trial in which Ashanti DeSilva was treated for SCID, did the therapeutic gene delivered to Ashanti replace the defective copy of the ADA gene? Why were white blood cells chosen as the targets for the therapeutic gene?
Bacteriophage lambda is as one of the routinely used molecular cloning vectors, which alsoserved as a model system for the study of bacteriophage morphogenesis, DNA replication, andgene regulation.a) With the aid of a diagram, generally narrate how a foreign gene can be inserted into alambda insertion vector and subsequently infect an Escherichia coli cell.b) You are cloning a 7.5 kb gene into a lambda gt10 vector, utilizing a restriction site whichspecifically present in the vector. State the restriction site that you can use for this purposeand suggest a screening procedure to indicate successful integration of the gene into thehost genome.
Researchers have successfully used gene therapy toameliorate some human genetic diseases by adding anormal gene copy to cells whose genomes originallyhad only nonfunctional mutant copies of that gene.For example, a form of blindness due to the lack of asingle protein called RPE65 has been reversed byintroduction of a normal RPE65 gene to cells of theretina of adults.a. The success of this gene therapy approach providesus with clues about the role of the RPE65 proteinin the retina. Do you think that RPE65 is neededfor the proper development of the human eye?b. Can you see a potential difficulty in applying this genetherapy approach for diseases like microcephaly?
Describe a ChIP-Seq experiment that will enable the identification of promoters to which the stationary phase sigma factor RpoS binds in E. coli. How could you also determine when RpoS binds to DNA?
Q. Which of the following statements about CRISPR-Cas9 is correct? A. It relies on the natural process of DNA repair. B. Regardless of the DNA target, the sequence of the guide RNA is always the same. C. Cas9 is only involved in recruitment of guide RNA to its target DNA. D. It is not precise enough to make a single base pair edit.
Propose some specific uses of a modified CRISPR-Cas system as a general RNA-guided device for altering cellular functions. What might these functions be, and how could CRISPR-Cas be used to study them?
The prospect of using gene therapy to alleviate genetic conditions is still a vision of the future. Gene therapy for adenosine deaminase deficiency has proved to be quite promising, but many obstacles remain to be overcome. Currently, the correction of human genetic defects is done using retroviruses as vectors. For this purpose, viral genes are removed from the retroviral genome, creating a vector capable of transferring human structural genes into sites on human chromosomes within target-tissue cells. Do you see any potential problems with inserting pieces of a retroviral genome into humans? If so, are there ways to combat or prevent these problems?
One concern about using genetically-modified organisms is that many of the methods used to create them introduce into the genome DNA from a different species (i.e. foreign DNA). Which of the following methods has the lowest potential of introducing foreign DNA into the genome?A. A gene knockout in mouse using homologous recombination in ES cellsB. Introduction of a P element vector into the Drosophila germ-lineC. Deletion mutations introduced by CRISPR/Cas9D. Microinjection of a transgene into a mouse pronucleus
Will genome editing emerge as the safest and most reliablemethod of gene therapy, rendering other approachesobsolete, or will a combination of approaches (vectorand nonvector delivery, RNA-based therapeutics, andgenome editing) be necessary depending on the geneticcondition being treated?
The ability to selectively modify the genome in the mouse has revolutionized mouse genetics. Outline the procedure for generating a knockout mouse at a specific genetic locus. How can the loxP-Cre system be used to conditionally knock out a gene? What is an important medical application of knockout mice?
During experimental RNAi, how does the researcher affect expression of a target gene? Group of answer choices Inject custom, lab-made double-stranded RNA into the specimen that will be targeted by the cell's existing Dicer to create siRNA complementary to the target gene's transcript. Inject lab-made Dicer proteins into the specimen which will cut up the target gene's transcript. Inject custom, lab-made siRNAs complementary to the target gene's transcript.
For this biology course and based on the results obtained from a previous BLAST search, the bacteria responsible for the infection at a Hospital is most likely a new strain of Escherichia coli. This strain is given the name E. coli AFB. Earlier, BLAST was used to study a resistance gene from E. coli AFB. These analyses suggest that this strain produces a new β-lactamase, which is given the name OXA-M290. Also, primers were designed to amplify the gene encoding OXA-M290 by PCR. The next step is to clone the PCR-amplified OXA-M290 gene into an expression vector, so that recombinant OXA-M290 protein can be produced and studied. You will start by going over the process of cloning the OXA-M290 gene into pET-28a. Be sure to reference a plasmid map for pET-28a. Here is the nucleotide sequence for the OXA-M290 gene: >OXA-M290 ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG…