1. What is the difference between an iterated blast (psi-blast) search and a simple blast search? 2. Arslan sequenced a gene in lab how he will know about the gene either it is novel discovery or gene is already present in the database? 3. Ruwaifa want to compares a nucleotide query sequence what option he will opt in BLAST and why? 4. Uzair has two protein sequences, he want to check their similarities what he will do? What results are expected
Q: A piece of human DNA is treated with two common restriction enzymes. The DNA piece in question is 50…
A: Restriction enzymes are a specific group of enzymes that can recognize a specific short sequence of…
Q: Devonte asked his colleague George to verify his results by repeating the sequencing experiment in a…
A: Sanger dideoxy sequencing method is also known in the genetics as chain-termination sequencing this…
Q: 22. Which statement is correct about restriction enzyme? They cut methylatedsite They cut…
A: Restriction enzymes are important enzymes in biotechnology that allow the isolation of a particular…
Q: For this activity you will draw out the first steps of the PCR reaction, using the following as a…
A: Introduction PCR is the revolutionized technique invented by Karry Mullis in 1983, for which he got…
Q: For each of the restriction enzymes listed below:(i) Approximately how many restriction…
A: Hello there! As you have posted multiple questions, we are answering only the first sub-part…
Q: 6. Refer to the figure answer the following questions. CLUSTAL W (1.83) multiple sequence alignment…
A: DNA is the genetic material for many multicellular organisms. The DNA present in all organisms is…
Q: With regards to this sequence below please answer this quistions 1) What is the format of the…
A: answer given below
Q: You are interested in amplifying the putative gene encoding the 480-bp protein TMR (Total Memory…
A: We are given with the gene that is needed to be amplified by PCR. The image shows a region of DNA…
Q: Mapping is the bioinformatics term used to describe alignment of sequence reads to a reference…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: Which of the following statements describe disadvantages of the classical Sanger sequencing approach…
A: Since you have posted multiple questions, we will answer the first question for you. If you need any…
Q: Read up on the latest developments in DNA sequencing, and present a summary of any one such…
A: DNA (deoxyribonucleic acid) sequencing is the technique of identifying or determining the order of…
Q: After properly troubleshooting, you finally are able to visualize the gel. You obtained the image…
A: DNA extraction is a protocol of isolating genomic DNA from any cell type. Generally we use the…
Q: Which of the following sequences in a bacterium CRISPR locus will vary and change O a. Spacer DNA…
A: CRISPER is a family of DNA sequences found in the genomes of prokaryotic organisms such as bacteria…
Q: The BLAST program is a tool fora. inserting many DNA fragments into a cell at the same time.b.…
A: With the formation of molecular biology as a branch of science, scientist began to work on the…
Q: Explain Shortly. I need help The emergence of new molecular biology techniques has allowed…
A: You have asked three parts of a question. Third part is a personal opinion on this topic, so I won't…
Q: DNA Extraction Using household materials Wash the fruit. Place the fruit (e.g. banana) in a zip…
A: The molecular biology applications involve protein and nucleic acid isolations. The process involves…
Q: You are assembling the genome sequence of a newly discovered bacterium by aligning a set of BAC…
A: Assembly involves taking a large number of DNA reads, looking for areas in which they overlap with…
Q: B. Genome Mining 1. Using the sequences from the previous activity, identify the organisms to which…
A: DNA sequencing - DNA sequencing refers to the general laboratory technique for determining the exact…
Q: Which one of the following options would be a good way to identify the location of the poly A tail…
A: Pre mRNA undergoes several post-transcriptional modifications. One of these modifications is…
Q: 1. Explain the steps associated with DNA profiling and state its advantages and disadvantages, 2.…
A: As per our guidelines, we are supposed to answer only one question. Since you have asked multiple…
Q: Two sequences aligned using one of the BLAST programs produce an alignment with an expected value…
A: *A BLAST alignment will have an pair of sequences in which every letter in one sequence is paired…
Q: Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR…
A: Polymerase chain reaction (PCR) is a method widely used to make many copies of a specific DNA…
Q: According to Picotti (2013), Rudi Aebersold (a leader in mass spectrometry-based proteomics) hopes…
A: The application of scientific and technical principles to the processing of the material by…
Q: 6. You perform a restriction digest that should yield 1,400 bp, 1,080 bp, 1,000 bp, and 400 bp…
A: There are different biomolecules, including DNA, RNA, proteins, etc., are present, and these…
Q: Arslan sequenced a gene in lab how he will know about the gene either it is novel discovery or gene…
A: Sequence alignment is an extensively used technique in the field of Bioinformatics. In this…
Q: NGS sequencing made it easy to generate COVID-19 sequences and compare them at different time…
A: The question is rejected because it is out of Q&A criteria.
Q: The bisulfite sequencing is different from regular sanger sequencing of nucleotides because…
A: The Sanger sequencing is also known as the chain termination method, it is a method used to…
Q: You performed RADseq analysis of two genomes using the restriction enzyme EcoRI. From each genome,…
A: * Restriction site associated DNA (RAD) markers are genetic marker that are used for association…
Q: EXPERIMENT #4: POLYMERASE CHAIN REACTION Purpose: Using PCR technique, amplify the region of…
A: PCR- polymerase chain reaction is defined as the process of amplification of the fragments of the…
Q: Describe the experiments done by Hershey and Chase That Verified That DNA was the genetic material.…
A: Introduction: Researchers determined that the element responsible for the transmission of features…
Q: What are the different elements you would need if you wanted to perform CRISPR to edit a gene?
A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…
Q: You've ordered and received your "primers" for your PCR. Now what? In your new role as an MLA your…
A: A primer is a short, single-stranded DNA sequence which is used in the polymerase chain reaction…
Q: 1. Genome annotation refers to all of the following except a. assigning a unique identifier given…
A: 1. Genome annotation refers to all of the following except Answer: e. All of the above are correct…
Q: Which of these is not a tool for comparing DNA sequences? O PLINK O A dotplot e.g. dotlet O Fasta O…
A: There are different tools in bioinformatics that help in sequencing and comparing the DNA sequences.…
Q: After you design the PCR primers, you run the PCR on fluid from the patient’s nasal swab. Next, you…
A: Gel electrophoresis is the widely used technique in molecular biology for the separation of the…
Q: SVCCPSLVARTNYNVCRLPGTEAALCATFTGCIIIPGATCGGDYAN Find the template? Use swiss model to build the…
A: The bioinformatic is major computational biology used to find the nucleotide, protein sequence of…
Q: 2: Align DNA sequences using dot matrix Horizontal sequence: AGGCTCCC; vertical sequence: GCGCTCCG.…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The current state-of-the-art in forensic DNA profiling involves the PCR-amplification and analysis…
A: PCR is a process in which millions of copies of a specific sequence of DNA can be made in a matter…
Q: In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into…
A: Genome of an organism includes all the cellular DNA of the organism; including nuclear, chloroplast…
Q: step 4, isopropyl alcohol is used to precipitate out the DNA because it is not soluble. What does…
A: Introduction: Pure DNA is needed for DNA analysis. In cells, DNA can be found. However, cells also…
Q: You have completed an in vitro mutagenesis experiment to create an G to T mutation in the coding…
A: In molecular biology, sequencing is the most important phenomenon in which the the behaviour and…
Q: Where do you expect to see multiple “Ns” within a sequencing read? a)Within the first 25…
A: Nucleotide sequences have their role in every aspect of genetic machinery. This includes…
Q: What is the program Finch TV used for? O Viewing next generation sequencing data O Opening…
A: We are answering the first question For second question pl repost Sanger sequencing is the mechanism…
Q: The following DNA fragment shows where a number of restriction endonucleases cut sites occur within…
A:
Q: Southern blotting is a method used in molecular biology for detection of a specific DNA sequence in…
A: Nucleic acid blotting is a well-established technique for locating a gene or sequence of interest…
Q: Which of the above nucleotides(s) (1/2/3) are used in DNA sequencing reaction? A nucleotides-x3.pdf…
A: DNA sequencing is a technique used to determine the exact sequence of bases in a DNA molecule. DNA…
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: You have completed an in vitro mutagenesis experiment to create an G to T mutation in the coding…
A: Introduction :- Sequencing is an process of characterizing sequences of biomolecules , particularly…
1. What is the difference between an iterated blast (psi-blast) search and a simple blast
search?
2. Arslan sequenced a gene in lab how he will know about the gene either it is novel
discovery or gene is already present in the database?
3. Ruwaifa want to compares a
BLAST and why?
4. Uzair has two protein sequences, he want to check their similarities what he will do? What results are expected
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1、You have a 250 bp DNA sequence from a human protein-coding gene. What's the best tool to find out which gene matches this sequence? BLAST A Clustal algorithm (such as Clustal Omega) A Burrows-Wheeler algorithm (such as BWA) Just Google it 2、Sequence alignment algorithms like Burrows-Wheeler were primarily designed to handle many (millions) of short sequences and match them to a reference genome efficiently. Another property of these algorithms makes them suitable for use with RNAseq data. What property is this? Burrows-Wheeler can distinguish which strand of reference genome matches a sequencing read. Burrows-Wheeler can align a sequencing read that matches two different exons. Burrows-Wheeler uses a pre-compiled and compressed index of the reference genome. Burrows-Wheeler can be parallelized.Devonte sequenced a novel gene using the Sanger dideoxy sequencing method. The resulting sequence he determined is shown below. CCGGATCGGGTTTCCGGGAATCGGGGG Devonte asked his colleague George to verify his results by repeating the sequencing experiment in a different lab. George was disappointed to find that his gel showed just one DNA band with a fluorescently labeled “G.” What did he leave out of the sequencing mixture? Devonte sequenced a novel gene using the Sanger dideoxy sequencing method. The resulting sequence he determined is shown below. CCGGATCGGGTTTCCGGGAATCGGGGG Devonte asked his colleague George to verify his results by repeating the sequencing experiment in a different lab. George was disappointed to find that his gel showed just one DNA band with a fluorescently labeled “G.” What did he leave out of the sequencing mixture? a)Primer b)DNA polymerase c)All ddNTPs d)All dNTPs1. How does PFGE separate larger fragments more efficiently than standard electrophoresis? 2. Why is SYBR green less toxic than EtBr? 3. What are the similarities and differences between Manual and Automated Sanger Sequencing? 4. What is the relationship between DNA fragment length and the distance it will run in a gel? (Restriction Enzyme Digestion)
- Q No. 2 Describe sequence alignment. What kind of information do we obtain from pair wise or multiple sequence alignment? Also write down their applications in the field of bioinformatics. Enlist some softwares used to perform alignment. Plz write the answer with headings of sequence alignment Pair wise alignment Multiple sequence alignment And the name of softwaresPerform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATTWith regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…
- Please answer ASAP RNA sequencing (RNA-Seq) of one sample in one run of a massively parallel sequencing platform is quite expensive. However, a way to circumvent this cost issue is to pool and sequence more than one sample. How would you be able to distinguish and identify the reads from different samples?Objective: Get a sense of how genomics, the study of the genome in its entirety,needs to think about how to go about its research. Geonomic DNA is broken up into fragments. The 5’ and 3’ ends of each fragment(a “read”) are sequenced. The sequenced reads are assembled together intocontiguous sequences (“contigs”) based on sequence similarity. The idea is to sequence enough random fragments so that every nucleotide in thegenome is represented on some read. The number of such fragments needed iscalled the coverage, c. The coverage c can be calculated by the formula RL/G, where R is the number ofreads sequenced, L is the average length of a read and G is the total length of thegenome. The units of length are bases (b) or base pairs (bp). Consider a genome whose length is 1000 bp. “Shotgun” sequencing techniquesare applied to the genome, resulting in 20 reads, with an average length of 50 bp.A very important point is that, even though 20 x 50 = 1000, there is no guaranteethat ALL…Objective: Get a sense of how genomics, the study of the genome in its entirety,needs to think about how to go about its research. Geonomic DNA is broken up into fragments. The 5’ and 3’ ends of each fragment(a “read”) are sequenced. The sequenced reads are assembled together intocontiguous sequences (“contigs”) based on sequence similarity. The idea is to sequence enough random fragments so that every nucleotide in thegenome is represented on some read. The number of such fragments needed iscalled the coverage, c. The coverage c can be calculated by the formula RL/G, where R is the number ofreads sequenced, L is the average length of a read and G is the total length of thegenome. The units of length are bases (b) or base pairs (bp). Consider a genome whose length is 1000 bp. “Shotgun” sequencing techniquesare applied to the genome, resulting in 20 reads, with an average length of 50 bp.A very important point is that, even though 20 x 50 = 1000, there is no guaranteethat ALL…
- NGS sequencing made it easy to generate COVID-19 sequences and comparethem at different time points. Using what you learn in the course you are able to analyzeCOVID-19 data at different waves.Requirements1. Use the GISAID database (GISAID) to download COVID-19 sequences (at leastten samples) at different time points.2. Perform multiple sequence alignment for your samples.3. Generate a phylogenetic tree and visualize it.4. Use BLAST to align COVID-19 spike protein with other viral spike proteins.5. Choose the most homologous protein and annotate it using ensemble or anypreferred database.6. All analysis steps must be delivered in bash scriptExamine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TGCTATC 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. This primer cannot be used in the PCR process. b. It will bind to the top strand on the left side of the fragment. c. It will bind to the bottom strand on the left side of the fragment. d. It will bind to the bottom strand on the right side of the fragment. e. It will bind to the top strand on the right side of the fragment.DNA ladder is attached (the picture shows HindIII as H, EcoRI as E, BamHI as B). Now, determine the size of fragments created by EcoRI and BamHI. In the graph attached there is the fragment size of HindIII. HindIII EcoRI BamHI Migration Distance (mm) Fragment Size (bp) Migration Distance (mm) Fragment Size (bp) Migration Distance (mm) Fragment Size (bp) 23455 11985 7430 4375 2150 1850