For this activity you will draw out the first steps of the PCR reaction, using the following as a short template. Take a picture of your drawing and upload it to this Question. 5' TTGCGTACGTGCATGTGTGCACATATGTCC 3' 3' AACGCATGCACGTACACACGTGTATACAGG 5° In your upload submission be sure to include: 1. Label the 5' and 3' end of the template and each primer, and indicate the direction in which polymerization will take place. 2. Write the sequence of a 10 base pair Forward primer and a 10 base pair Reverse primer binding to the template strand. Add an arrow showing which direction polymerization will take place 3. Add a DNA polymerase to the drawing above showing where the polymerase will bind. 3. Draw and label a DNTP nucleotide. Show how this monomer gets incorporated into a new DNA strand?

For this activity you will draw out the first steps of the PCR reaction, using the following as a short template. Take a picture of your drawing and upload it to this Question. 5' TTGCGTACGTGCATGTGTGCACATATGTCC 3' 3' AACGCATGCACGTACACACGTGTATACAGG 5° In your upload submission be sure to include: 1. Label the 5' and 3' end of the template and each primer, and indicate the direction in which polymerization will take place. 2. Write the sequence of a 10 base pair Forward primer and a 10 base pair Reverse primer binding to the template strand. Add an arrow showing which direction polymerization will take place 3. Add a DNA polymerase to the drawing above showing where the polymerase will bind. 3. Draw and label a DNTP nucleotide. Show how this monomer gets incorporated into a new DNA strand?

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

You want to amplify the following sequence of DNA from a gene of interest that you are studying. To do this, you will use PCR. Design a forward and reverse primer. Show where the primers anneal to the template sequence. Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’ TACTGCCTTATATTCGACCACCACCACC---CCGACGTACTCGACGTTCACACACGAGAGGATT 5’ (PLEASE EXPLAIN STEP - BY STEP) Answer : Foward primer 5": Reverse primer 3"
The target sequence for a PCR amplification is shown below. When the final cycle of PCR has ended, the resulting amplicon will be how many base pair (bp) long? 5' ACGTGCGAGCACGTATATATGTCGCGTGCTGAGTGTAGCGTATGCGAATCACCGC 3' 3' TGCACGCTCGTGCATATATACAGCGCACGACTCACATCGCATACGCTTAGTGGCG 5' 31bp 39bp 42bp 47bp None of the above
.How much PCR product (500 bp) should be added to a ligation in which 50 ng of Vector (6.6 kb) vector will be used if a 3:1 insert:vector molar ratio is desired? Vector concentration is 50 ng/uL and insert concentration is 35 ng/ul. Provide mass and volumes for the ligation reaction
Look at each PCR component listed below. For each one, determine which steps(s) of the PCR reaction (denaturation, annealing or extension) would be directly affect if that component were missing. Taq polymerase: Oligonucleotide primers: DNA template: Deoxynucleotides (A, T, G and C): Imagine that you correctly prepare your PCR reaction mixture, but there is something wrong with the thermal cycler. Describe what would happen if: The thermal cycler was stuck on 940C: The thermal cycler cycled between 600C and 720C, but never reached 940C The thermal cycler cycled between 940C and 720C, but never reached 600
A PCR reaction was performed to amplify the CHE2 gene. The PCR primers used were designed to amplify bp 936-4,635 of a 10,908 bp plasmid. Calculate the expected PCR product size (in bp).
Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TGCTATC 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. This primer cannot be used in the PCR process. b. It will bind to the top strand on the left side of the fragment. c. It will bind to the bottom strand on the left side of the fragment. d. It will bind to the bottom strand on the right side of the fragment. e. It will bind to the top strand on the right side of the fragment.
After you did the amplification by PCR, you run the product on 2% gel. Tell me how did you prepared the gel if the tray is 150 ml? how many milliliters of the TBE and how many grams of the Agarose? Draw a picture (On a paper or on computer) for the gel that you are expecting, the gene that you amplified is approximately 200 bp
The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product which is cloned into a 1.5 kb plasmid for bacterial expression. What would the agarose gel look like, including a lane for markers, and where would the following pieces of DNA run: 1. the PCR insert 2. the empty uncut plasmid 3. the empty plasmid cut with a single restriction enzyme 4. the cloned plasmid containing the insert
Above what amplicon size is this PCR reaction dNTP limited? The reaction contains 35 pmoles of each 24 base primer, 1.2 mM dNTP's and is 40 uL in volume. Answer in base pairs, but don't include the unit in your answer
The final amount of each primer required in a PCR reaction is 25 picomol. If the total volume of the PCR reaction is equal to 100 µl and the stock concentration of each primer is equal to 0.0025 mM. Calculate the volume of stock primer that needs to be added in order to ensure a primer amount of 25 picomol.
You are setting up your PCR reaction and accidentally add twice as much of the salt buffer as you were supposed to. Select all that apply. 1. How will this impact product formation? 2. In what way(s) will the reaction be altered? (a) ...because primer/template binding will be altered (b) ...because the mechanism of dNTP addition will be altered. (c) You will get more of the desired PCR product... (d) ...because template denaturation will be altered. (e) You will get the same amount of the desired PCR product... (f) You will get less of the desired PCR product...
You wish to amplify a segment of DNA from a plasmid template by PCR with the use of the following primers: 5’-GGATCGATGCTCGCGA3' and 5' -AGGATCGGGTCGCGAG-3'. Despite repeated attempts, you fail to observe a PCR product of the expected length after electrophoresis on an agarose gel. Instead, you observe a bright smear on the gel with an approximate length of 25 to 30 base pairs. Explain these results.