(11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of the nucleotide in the genomic DNA sequence below will be cut by Cas9 protein, which may lead to a knockout due to an error in DNA repair? The starting and the end coordinate positions of the DNA fragment on the chromosome are indicated at the beginning and end of the sequence, respectively.

(11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of the nucleotide in the genomic DNA sequence below will be cut by Cas9 protein, which may lead to a knockout due to an error in DNA repair? The starting and the end coordinate positions of the DNA fragment on the chromosome are indicated at the beginning and end of the sequence, respectively.

Name: (11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: (11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory whichposition of the nucleotide in the genomic DNA sequence below will be cut by Cas9 protein, which maylead to a knockout due to an error in DNA repair? The starting

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence: CGA AAA GAG AAT A mutation in the above sequence involved a substitution of a single base, resulting in an incomplete protein due to a nonsense mutation. Which of the following gen sequences exemplifies the mutation described above? a. CGA UAA GAG AAT b. CGA AAA AAG AAT c. CGA AAA GAG ACT d. UGA AAA GAG AAT
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′3′ … AACTGT … ATATTA … 5′a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand?
1. This complex assembles and organizes nucleosomes and contributes to gene repression Group of answer choices a. SWR1 Complex b. ISWI Complex c. SWI/SNF Complex d. SWI Complex 2. A DNA lesion occurring when the deoxyribose molecule loses an adenine or a guanine base. Group of answer choices a. Depurination b. Deamination c. Depyrimination d. Denaturation 3. The difference between a nucleoside and nucleotide is: Group of answer choices a. Nucleotides contains deoxyribose sugar and nucleosides contain ribose sugar b. A nucleoside consists of the sugar with a nitrogenous base, whereas a nucleotide has sugar with a nitrogenous base and phosphate groups attached to the sugar. c. A nucleotide consists of the sugar with a nitrogenous base, whereas a nucleoside has sugar with a nitrogenous base and phosphate groups attached to the sugar. d. Nucleotides are involved in eukaryotic DNA replication, while nucleosides are used in bacterial DNA replication
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Below are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:
GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH IS THE mRNA AND THE POLYPEPTIDE THAT IS FORMED FROM THE SEQUENCE DNA 5' atgagtaaagga 3'