Gene transcription occurs from left to right for gene A and gene B, whereas transcription occurs from right to left for gene C, as in the diagram. 5'- 3' Gene A Gene B Gene C 3' 5' Therefore, the template strand for gene A is the strand, the template strand for gene B is the strand, and the template strand for gene C is the strand,

Gene transcription occurs from left to right for gene A and gene B, whereas transcription occurs from right to left for gene C, as in the diagram. 5'- 3' Gene A Gene B Gene C 3' 5' Therefore, the template strand for gene A is the strand, the template strand for gene B is the strand, and the template strand for gene C is the strand,

Name: Gene transcription occurs from left to right for gene A and gene B, w
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Gene transcription occurs from left to right for gene A and gene B, whereas transcription occurs from right to left for gene C, asin the diagram.5'.3'Gene AGene BGene C3'-5'Therefore, the template strand for gene A is thestrand, the template strand

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

The following represents a transcription unit in a hypothetical DNA molecule in E.coli. (Transcription can use either strand, but by convention we always put 5’à 3’ on the top.) 5’…..TTGACANNNNTATAAT…3’ 3’…..AACTGTNNNNATATTA…5’ If this molecule is transcribed from left to right, then the ____ strand will be the template strand and the ___ strand will be the non-template strand. top, bottom bottom, top
Shown below are three genes (gene 1, gene 2, and gene 3) located on the same bacterial chromosome. a) Indicate where on the diagram you would find the following for each gene: Promoter (p1 for gene 1, p2 for gene 2, and p3 for gene 3) Transcription termination site (tts1, tts2, and tts3) Start codon (start1, start2, and start3) Stop codon (stop1, stop2, and stop3) Template strand (ts1, ts2, and ts3), the DNA strand that directs RNA synthesis Be sure to indicate the component on the appropriate molecule (DNA or RNA).
A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of the following sequences would be produced as a result of transcription? Group of answer choices CGTUUTCAG CGAUUACUG GCUAAUGAC GCTAATGAC
How is the template strand the one being transcribed but the coding strand is the one that has the promoter and +1 site on it?
The coding sequence for gene F is read from left to right on the accompanying figure. The coding sequence for gene G is read from right to left. Which strand of DNA (top or bottom) serves as the template for transcription of each gene?
Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
Select the events from eukaryotic transcription from the list below and list them below in order, by letter, from earliest to latest during transcription. A. Sigma factor binds 5'TTGACA?' B. Rho separates DNA/RNA hybrid C. TFIID binds TATA Box D. RNA Pol Il binds E. Holoenzyme forms F. Template strand is used to synthesize a 5' to 3' polymer G. Transcript is moved into the cytoplasm H. U1, U2, U4, U5 and U6 sn RNPs bind transcript
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.