pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA strand that encoded this short stretch of RNA.(b) Using the simplest convention for representing the DNA base sequence, write the structure of the nontemplate DNA strand.

Q: For some DNAs, it is possible to separate the two strands, after denaturation,in a CsCl gradient.(a)…

A: Denaturation is a process in which proteins or nucleic acids lose the quarternary structure,…

Q: Why is the double-helical structure of DNA stabilized at moderate to high ionic strength?

A: Ionic strength defines the high concentration of ions in the solution that are produced due to the…

Q: 4A. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red…

A: The genetic information always flow from DNA to RNA to proteins. This flow of information is known…

Q: 16)(comprehension) Suppose the following DNA sequence was mutated from 3'-AGAGAGAGAGAGAGAGAG-5' to…

A: The central dogma states that DNA undergoes transcription to form mRNA which then gets translated to…

Q: Examination of the structure of DNA polymerases bound to nucleotide analogs reveals that conserved…

A: DNA polymerase is a member of a family of enzymes that catalyse the synthesis of DNA molecules from…

Q: stranded helix by doubling back. Draw the detailed chemical structures for all the base- pairing…

A: Triple helix The triple-stranded DNA is also called the H-DNA, it is called so because three…

Q: 23. What process best describes the action of Taq DNA polymerase? a. Catalyzes hydrolysis of…

A: Taq DNA polymerase is the thermal stable DNA polymerase enzyme isolated from Thermus aquaticus. This…

Q: Write a balanced equation for the hydrolytic deamination of a DNA- 5-methylcytosine residue.

A: Deamination is the process of breaking down amino acids in which amino group is converted into…

Q: Close contact. Examination of the structure of DNA polymerases bound to nucleotide analogs reveals…

A: DNA polymerases are the enzyme that replicates DNA in cells. DNA polymerase can not create new…

Q: DNA polymerase I, DNA ligase, and topoisomerase I catalyze the formation of phosphodiester bonds.…

A: The DNA replication is a semi-conservative mechanism in which the new complementary strand is…

Q: Describe the d=features of the following DNA-binding domains and how they interact with DNA.…

A: DNA-binding domain abbreviated as DBD is a protein domain that is folded independently and contains…

Q: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne…

A: Permutation infers the maximum number of possible arrangements by given things/ variables that can…

Q: A solution  containing single stranded DNA with the sequence 5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTNNNNN’3…

A: In biology, DNA replication is that the process of forming 2 identical replicas of deoxyribonucleic…

Q: List three mechanisms that relax the twisting stress in helical DNA molecules.

A: The Structure of deoxyribonucleic acidREFLECT AND APPLY List 3 mechanisms that relax the twisting…

Q: 1. For this oligonucleotide, • dassify if RNA or DNA? Justify your choice. • determine the sequence…

A: Deoxy ribose nucleic acid or DNA has a Ribose sugar with deoxy hydroxyl group at 2'carbon. Ribose…

Q: This is Fos-Jun dimer (1FOS). Is the leucine zipper at the C-terminus or at the N-terminus of the…

A: Fos-jun family proteins are a class of proteins that belong to a large group of DNA binding proteins…

Q: In Figure 1-8b, can you tell if the number of hydrogenbonds between adenine and thymine is the same…

A: DNA (Deoxyribonucleic acid ) the building blocks of DNA are the Nucleotides Nucleotides are made up…

Q: Write a balanced equation for the hydrolytic deamination of a DNA5-methylcytosine residue.

A: 5-Methylcytosine is a methylated form of the DNA base cytosine (C) that regulates gene transcription…

Q: The two sides of the DNA double helix are con cytosine, and guanine). Because of the geo bonds with…

A: The Chargaff's base-pairing rule governs base pairing in DNA (deoxyribonucleic acid). According to…

Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…

A: First a coding strand forms its complementary template strand during replication. Then m RNA is…

Q: Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must…

A: Insulin is synthesized from preproinsulin. The preprotein is then cleaved by a proteolytic enzyme to…

Q: Spontaneous deamination of cytosine bases in DNA takes place at low but measurable frequency.…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Write a balanced equation for the hydrolytic deamination of a DNA-5- methylcytosine residue.

A: Deamination reaction is the removal of an amino group from an amino acid and this reaction was…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature formula :  Tm = 4* (G+C) + 2 * (A+T)  Number of G+C = 6  Number of A+T = 20

Q: 23. Contrast the “functional” size of the four major classes of biomolecules.  Background: Up…

A: Carbohydrates, proteins, lipids, and nucleic acids are the four major biomolecules. Carbohydrates…

Q: 6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA (deoxyribonucleic acid) often experience changes as a result of replication errors or…

Q: 19. For the helix in double-stranded B-form DNA, the majority of the stability of the DNA can be…

A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the…

Q: 6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ?…

A: Nucleosides contain only sugar and a base whereas Nucleotides contain sugar, base, and a phosphate…

Q: 6. a. The double helical structure of DNA is intrinsically unstable and easily dissociates to form…

A: Biomolecules are organic molecules that function inside living organisms. They are categorized as…

Q: As shown, five DnaA boxes are found within the origin of replication in E. coli. Take a look at…

A: E.coli. is a key model organism and has been used in so many research studies involving molecular…

Q: I only need letter D

A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…

Q: Amino acids have an average molar mass of 100 g/mol.How many bases on a single strand of DNA are…

A: Given: molar mass = 5.0×105 g/mol = 500000 g/mol average molecular weight of an amino acid = 100…

Q: Compare the melting temperature of a 1-kb segment of DNA containing20% A residues to that of a 1-kb…

A: The temperature at which 50% of double-stranded DNA is changed into single-stranded DNA is called…

Q: 17. How would you computationally predict the thermodynamic stability of a long, extended RNA helix?…

A: Thermodynamic stability is the state when the structure is in a conformation that has the lowest…

Q: "The helix must undergo localized unwinding, and theresulting “open” configuration must be…

A: DNA is the genetic and hereditary material in all living cells (except a few viruses). DNA is passed…

Q: With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the…

A: The process by which DNA gets converted into RNA molecule is called as transcription and then mRNA…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: The single stranded DNA can fold back and base-pair with itself, thus providing both template and…

Q: Cordycepin (structure shown), a broad-spectrum antibiotic was used to treat a bacterial infection.…

A: Antibiotics are potent medications that fight infections and, when taken correctly, can save lives.…

Q: AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What…

A: Short Tandem Repeats(STR) or microsatellites or simple sequence repeats(SSR) are short sequences of…

Q: Base analysis of DNA from maize (corn) shows it to have 23 mole percent cytosine (moles per 100…

A: Gene is the basis of all living system as it consists of the hereditary information of the organism…

Q: 3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs…

A: The process of formation of mRNA(messenger ribonucleic acid) molecules on the DNA(deoxyribonucleic…

DNA and RNA

Deoxyribonucleic acid (DNA) is usually called the blueprint of life. Deoxyribose is a monosaccharide that has a key function in the synthesis of deoxyribonucleic acid. One less oxygen-containing hydroxyl group occurs in deoxyribose sugar. Nucleic acid, deoxyribonucleic acid, is one of the natural components. Deoxyribonucleic acid is a double-stranded molecule. Watson and Crick postulated the double-stranded model of the helix. A deoxyribonucleic acid is a molecular group that carries and transmits genetic information from parents to offspring. All eukaryotic and prokaryotic cells are involved.

DNA as the Genetic Material

DNA, or deoxyribonucleic acid, is a long polymeric nucleic acid molecule discovered in the late 1930s. It is a polymer; a long chain-like molecule made up of several monomers connected in a sequence. It possesses certain characteristics that qualify it as a genetic component. Certain organisms have different types of nucleic acids as their genetic material - DNA or RNA.

Genetics

The significant branch in science which involves the study of genes, gene variations, and the organism's heredity is known as genetics. It is also used to study the involvement of a gene or set of genes in the health of an individual and how it prevents several diseases in a human being. Thus, genetics also creates an understanding of various medical conditions.      

DNA Replication

The mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of its own is defined as DNA replication. The DNA molecules utilize a semiconservative method for replication.