1b: Do DNA fragments move towards the positive or negative end of the gel box? Explain your answer. 1c: What is the purpose of the Tris-Acetate-EDTA (TAE) buffer that the agarose gel is prepared with and submerged in for running? What would happen if you used water to prepare and run the gel instead of TAE buffer? 1d: If the student is homozygous for the brown allele, how many bands will they see in the lanes for the blue and brown allele samples? (circle one)
Q: Assume that mitochondria contain 0.23 Molar KCL and 0.010 Molar NaCl. Calculate the grams per liter,...
A: KCl will dissociate into K+ and Cl-. However, NaCl will dissociate into Na+ and Cl-. Therefore, both...
Q: explain why ATP is utilized as the primary energy currency in cells. Your answer must include a comp...
A: Adenosine triphosphate (ATP) is a hydrotrope and an organic substance that supplies energy for vario...
Q: 1. Calculate Vmax and Km???
A: Enzymes are usually a protein molecules that catalyzes the biochemical reactions without being consu...
Q: My question is The 2 types of photoreceptors cells within the retina are ______________ and ____...
A: GPCR is a cell surface receptor, which is linked to a G protein (guanosine binding protein). Gαt (Gα...
Q: 6 A blocked cat is presented to your clinic. His lab work indicates his serum potassium is 7.6 mmol/...
A: Calculation to make dextrose:
Q: A chain of biochemical events is responsible for Aequorea victoria turning green. Firstly, the prote...
A: Gel Filtration chromatography or size exclusion chromatography is a chromatographic technique of sep...
Q: ou have given two proteins with a pI of 4.5 and pI of 7.7? Using an anion-exchange column, how can t...
A: Ion-exchange chromatography: The method involves the separation of ions and polar molecules based o...
Q: 5. If enzymes are truly specific, they will catalyze the reaction of one substrate only. Predict whe...
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer ...
Q: What two 3-carbon molecules are generated by the cleavage of fructose-1,6-bisphosphate? A) glycerald...
A: GLYCOGENESIS :- conversion of glucose ( 6 carbon sugar) to pyruvate (3 carbon product). 6C sugar bre...
Q: In a mixture of five proteins listed, draw an elution profile (Absorbance vs. mL eluted, arbitrary)...
A: Size-exclusion chromatography also known as gel filtration chromatography, is a chromatographic tech...
Q: You have obtained experimental kinetic data for two versions of the same enzyme, a wild‑type and a m...
A: Michaelis-Mention constant (Km) or equilibrium constant for the dissociation of the E-S complex is e...
Q: Explain the consequence of the following structures.
A: The given structure represents the phospholipid molecules in a lipid bilayer. Phospholipids are comp...
Q: Find a procedure for determining phosphorus content in fertilizer other than the gravimetric method
A: The phosphorus content in fertilizers can be measured spectrophotometrically after treating the samp...
Q: Signal Molecule- Somatostatin Receptor Name- Somatostatin receptor type 2 Draw the structure of the ...
A: Somatostatin is a peptide hormone secreted by the δ cells of pancreas. The signal molecule here is t...
Q: Hello, please answer the questions 1, 2, 3, 4, 5, 6, and 7 directly 1. What is isoelectric precipit...
A: Hi, thank you for posting the question on Bartleby. As per the guidelines we can answer first three ...
Q: A 100-mL buffer solution with pH of 4.80 is prepared as a stock solution. Using this stock buffer so...
A: Hi! Thank you for the question. We are authorized to answer two subparts at a time, since you have n...
Q: Directions: Supply the missing information. Amino Acid Sequences of in Cytochrome-c ANIMAL AMINO ACI...
A: Cytochrome C is a mitochondrial protein that is found in the mitochondria. It is highly water solubl...
Q: 1.) What nitrogenous base would not be expected in structure C? 2.) What nitrogenous base would not ...
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which o...
Q: UDP , gemcitabine was shown to undergo two successive phosphorylations at . The product, gemcitabine...
A: GEMCITABINE is a chemotherapy medication, used to treat cancer such as breast cancer, testicular can...
Q: How would your body look without epithelial tissue. What would be missing on the outside and on the ...
A: The answer of the following question is given below
Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your ami...
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer ...
Q: 1. Compare and contrast DAT from IAT based on procedure and clinical significance. 2. Explain the i...
A: Given: 1. Comparison and contrast DAT from IAT based on procedure and clinical significance. ...
Q: If your sepharose beads are covalently attached to adrenaline hormone, which of the following protei...
A: Affinity chromatography is a biochemical technique which is used to separate molecules based on the ...
Q: 1. it is used to selectively bind K+ causing an impedance change that can be correlated to K concent...
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which o...
Q: How do the levels of structure achieved in proteins?
A: Proteins are classified into two types Globular proteins and fibrous proteins. Proteins have f...
Q: 1. Maltose is a disaccharide of, Explain in 2-3 sentences why you chose this answer. A. glucose and ...
A: Disaccharides are formed when two monosaccharides are joined together and a molecule of water is rem...
Q: 1. What is the type of bond formed between the two orange R groups? 2. What is the type of bond form...
A: Introduction - The alpha helix is a common motif in the secondary structure of a protein and is a ri...
Q: What are the three major classes of carbohydrates? Describe each in one sentence
A: CARBOHYDRATES:- carbs, sugars molecules found in potatoes, rice, and many other food items. Empheric...
Q: What hormone directly opposes the actions ofnatriuretic hormones?a. reninb. nitric oxidec. dopamined...
A: Natriuretic hormones (NH) are compounds that act in an endocrine or paracrine fashion to modify extr...
Q: Use Seliwanoff's test to distinguish fructose and surcose. If not possible, provide a reason.
A: The Seliwanoffs test is a test that is used to distinguish between aldose and ketose sugar. Upon hea...
Q: 1. What specific CK isoenzyme in ion acid following the attack of myocardial infarction? 2. What ar...
A: Isoenzymes are enzymes that differ in amino acid sequence but catalyze the same chemical reaction. T...
Q: Straight hair can be curled and curly hair can be straightened by exposing wet hair to a reducing ag...
A: The innermost part, or the root, of your hair is called a hair follicle. Hair follicles anchor each ...
Q: 1.) What are the main structural features of the polysaccharides starch? 2.) How do this aid in its ...
A: Starch is a homopolysaccharide. It is the carbohydrate reserve of the plants. It is an important die...
Q: Crystal: Calcium oxalate or calcium phosphate in kidney stones If it is something harmful, what can...
A: A kidney stone is a solid, marble-like piece of material that forms in one or both kidneys. It forms...
Q: 1. How does real-time polymerase chain reaction work? 2. How is SYBR Green used in the experiment? W...
A: A real time polymerase chain reaction is used for amplification of DNA molecules in real time. It is...
Q: CH HC CH, | - Polypeptide backbone CH2 HC CH, CH - CH2¬S–5}-CH,-- OH -CH;-CH;-CHy-CH, NH," 0-ċ-CH,- ...
A: The structural organization of protein was classified into four different types and they are primary...
Q: Imagine an allosteric enzyme is modified so that it exists 100% in the R state or 100% in the T stat...
A: Based on the substrate concentration, an allosteric enzyme at a specific instance can be said to be ...
Q: Explain the consequence of the following structures
A: A cell membrane surrounds every cell, forming a barrier between the cell and its environment. The ph...
Q: Explain why the maximum initial reaction rate cannot be reached at low substrate concentrations
A: Multiple questions asked. I will answer the first question, as allowed by guidelines. Please repost ...
Q: The energy stored in a foot of snow on a steep roof is________.a. potential energyb. kinetic energyc...
A: Energy exists in several forms, but it is not created nor destroyed; rather, it just transitions fro...
Q: QUESTION 6 Enzyme chymotrypsin cleaves polypeptides after aa. O Positively charged O Large, non-pola...
A: Chymotrypsin is a digestive enzyme. This enzyme belongs to the family of enzymes called serine prote...
Q: Exercises: Directions: Complete the following lines for frame shift mutations. Write each codon on t...
A: Insertion mutation involves addition of genetic material in the form of nitrogen base to the reading...
Q: Please post answer with an explanation, thank you! 1. The compound carboxymethyl-CoA (shown below) i...
A: Transition state analogues are short lived versions of the substrate during the course of an enzyme ...
Q: 3. What is the name of the molecule in the circled regien labelled M (be specific)? How do you know?...
A: Q5.DNA is composed of nucleotides, which are phosphate, sugar, and nitrogen base complexes. bases ar...
Q: Polar Group Hydrophilic Head (Polar) Phosphate Glycerol Fatty acid chain Fatty acid chain
A:
Q: Voer die titrasie uit op die peptied Ala-Lys-His-Ala uit / Do the titration on the peptide Ala-Lys-H...
A: Here Ala-His-Lys-Ala is a tetra peptide consist of two alanine at two end, one His and One Lys. The ...
Q: Calculate the enzyme and specific activity of a reaction with 3 μM Hsp90 using the following inform...
A: Given Values: The molecular weight of the Hsp90 = 82.7 kDa Concentration of Hsp90 = 3 μM Molar Extin...
Q: Assume you have an SAR of 0.206 for sample 1; 0.271 for sample 2; and 0.606 for sample 3, what does ...
A: The SAR values indicates that:
Q: Draw the following amino acids interactions: 1. H-bond - between -0H of Serine amino acid and C=0 b...
A: A hydrogen bond is formed between a hydrogen atom which is covalently bound to a more electronegativ...
Q: 1. Enumerate and describe the classification of steroids. 2. What is the importance of determining ...
A: Steroids are defined as an organic compound with four rings consisting of 17 C-atom called steroid n...
Do not do the part a of the question attached
do the rest of the parts ( b,c,d,e,f)
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHHow is the color of the spot coverted into useful data if data is collected from a Vicrochip DNA microarray that's from the colors of spots that illuminate when the spots have a laser shine on them? From the following which one is the best option The color of the spot is converted to a number that represents the intensity of green or red, so that the numerical intensity values can be compared between spots by a computer program The color of the spot is bright so that it can be interpreted visually by trained scientists The color of the spot is present on the chip, counted and a ratio of red-yellow and green-yellow is calculated which can be done by hand The color of the spot can't be converted None of the aboveCan you please help with 1d please picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC…
- Match the PCR sample with the predicted result on the agarose gel. 1) Sample from individual homozygous for their PV92 locus with the Alu insert. Five bands of 100, 200 500, 700 and 1000bp Single band of 300 bp Two bands one of 300 bp and one of 641bp Tow bands one of 641 bp and one of 941 bp No Bends Single band of 941 bp Single band of 641bp 2) Sample from individual homozygous for their PV92 locus without the Alu insert. Five bands of 100, 200 500, 700 and 1000bp Single band of 300 bp Two bands one of 300 bp and one of 641bp Tow bands one of 641 bp and one of 941 bp No Bends Single band of 941 bp Single band of 641bp 3) Sample from individual heterozygous for their PV92 locus having the Alu insert. Five bands of 100, 200 500, 700 and 1000bp Single band of 300 bp Two bands one of 300 bp and one of 641bp Tow bands one of 641 bp and one of 941 bp No Bends Single band of 941 bp Single band of 641bp 4) Negative control sample. Five bands of 100, 200 500, 700 and 1000bp…For the given restriction enzyme: BslI (CCNNNNN^NNGG) i) Approximately how many fragments would result from digestion of the human genome (3 × 109 bases) with the enzyme? ii) Estimate the average size of the pieces of the human genome produced by digestion with the enzyme. iii) State whether the fragments of human DNA produced by digestion with the given enzyme would have sticky ends with a 5′ overhang, sticky ends with a 3′ overhang, or blunt ends. iv) If the enzyme produces sticky ends, would all the overhangs on all the ends produced by that enzyme on all fragments of the human genome be identical, or not? The recognition sequence on one strand for the enzyme is given in parentheses, with the 5′ end written at the left. N means any of the four nucleotides; R is any purine—that is, A or G; and Y is any pyrimidine—that is, C or T. ^ marks the site of cleavage. Note that the recognition sites containing Ys and Rs are not always rotationally symmetrical.ARE THEY TRUE OR FALSE? a) In a caesium chloride density gradient centrifugation method performed in the presence of ethidium bromide, supercoiled plasmid DNA binds more ethidium bromide than linear DNA. B)Tth DNA polymerase shows DNA-dependent DNA polymerase activity as well as RNA-dependent DNA polymerase activity. C)Magnesium ions stimulate polymerase activity. Therefore, it is better to use the highest concentration of magnesium in PCR amplification. D)When lambda bacteriophage infects E. coli cell lysis never occurs, and the infected bacterium can continue to grow and divide. E)The copy number refers to the number of molecules of an individual plasmid that are normally found in a single bacterial cell. F)RNase H selectively hydrolyzes phosphodiester bonds of RNA molecules in RNA:DNA duplexes.
- Can you please help with 1c please picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC…DNA from 100 unrelated individuals from one population of Chinook salmon were amplified at a single microsatellite locus, and run on an agarose gel. The results from gel electrophoresis shows three different fragment lengths (i.e. alleles/band positions) corresponding to 3 alleles; Allele F (250bp), Allele R (180bp), and Allele Y (100bp). The numbers at the top of each lane is the number of fish observed with that particular genotype or banding pattern in the population. Note that a single band means a homozygote for that allele (band size). a) Calculate the allele frequency for Allele Y. (b) Calculate the genotype frequencies for the following genotypes: FF, FR, and RY. (c) What is the expected number of Chinook salmon with homozygous genotype for allele Y in the study population? (d)What is the name of the statistical test that you could conduct to test whether this population of Chinook salmon is in Hardy Weinberg EquilibriumA method for detecting methylated CpGs involvesthe use of a chemical called bisulfite, which convertscytosine to uracil but leaves methylated cytosine untouched. You want to know whether a particularCpG dinucleotide at one location in the genome ismethylated on one or both strands in a tissue sample.The genomic sequence containing this CpG is:5’...TCCATCGCTGCA…3’. You take genomicDNA from the sample tissue, treat it exhaustivelywith bisulfite, and then use flanking primers toPCR-amplify the region including this CpGdinucleotide. You then want to Sanger sequence(see Fig. 9.7) the amplified PCR product. a. After you treat genomic DNA with bisulfite, the twoDNA strands will melt into single strands. Why?b. Your answer to part (a) introduces a potential complication, because if you do not account for this result of bisulfite treatment, the PCR primers willnot amplify the DNA. What special considerationswould be necessary when you design your PCRprimers for this experiment? Could one pair…
- High doses of caffeine interfere with the DNAdamage response in mammalian cells. Why then do yousuppose the Surgeon General has not yet issued an appro-priate warning to heavy coffee and cola drinkers? A typicalcup of coffee (150 mL) contains 100 mg of caffeine (196 g/mole). How many cups of coffee would you have to drinkto reach the dose (10 mM) required to interfere with theDNA damage response? (A typical adult contains about 40liters of water.)In eukaryotes, Cot DNA reassociation curves are not smooth. They have bumps. Why? What are the bumps?Suppose you are constructing a human genomic library in BAC vectors where the human DNA fragments are on average 100,000 bp. a. What is the minimum number of different recombinant BACs you need to construct in order to havea greater than zero chance of having a completelibrary—meaning one in which the entire genomeis represented?The simple statistical equation that follows allows youto determine the size that a genomic library needs tobe (that is, the number of independent recombinantclones you need to make) for a given likelihood thatthe entire genome is represented in the library.N = ln (1 − P)ln (1 − f )In the equation, N is the number of independent recombinant clones; P is the probability that any particular partof the genome is represented at least one time; f is thefraction of the genome in a single recombinant clone.(Note: ln is the natural log, sometimes written as loge.)b. Calculate f for the genomic library described in part (a).c. How many different recombinant BAC…