1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your amino acid sequence, perform point mutation to written codon for THR in the first and the second position, and discuss results in terms of shifting physicochemical properties.
Q: 2. The diagram below shows the structure of a sugar. ÇH2OH C=0 Но -H- но ČH2OH a. Is the sugar an al...
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for y...
Q: Briefly describe 5 major types of lipids.
A: Lipids are macromolecules that are made up of fattyacids and glycerol. The composition varies depend...
Q: State the purpose of DNA replication and describe the process
A: DNA (deoxyribonucleic acid) is the genetic material which plays an important role in the transfer of...
Q: Indicate the COOH-pKa value of the HAY tripeptide on the titration curve. Titration curve of tripept...
A: The titration curve of peptides indicates the buffering zones and the pKa value of each ionic specie...
Q: What is the role of chloride in biochemical processes of the body? 2. What are the other test for ...
A: Body has different electrolytes. Chloride being one of the most important electrolytes in the blood
Q: . Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling ...
A: The answer of the following question is given below.
Q: 1. in cherry crandall method for lipase analysis what is the substrate used?
A: As you have asked multiple questions, we would solve first question for you. If you specific questio...
Q: How is catabolism exergonic and how is anabolism endergonic? Kindly point out the difference in the ...
A: Carbohydrates, proteins, and lipids are macronutrients that provide energy and vital basic materials...
Q: A 100-mL buffer solution with pH of 4.80 is prepared as a stock solution. Using this stock buffer so...
A: Hi! Thank you for the question. We are authorized to answer two subparts at a time, since you have n...
Q: Explain the consequence of the following structures
A: A cell membrane surrounds every cell, forming a barrier between the cell and its environment. The ph...
Q: Does your protein 3GRS have a quaternary structure??? talk about the tertiary structure of 3GRS. h...
A: All molecular models (atomic coordinate file) based on the X-ray crystallographic data of the struct...
Q: 1.) What are the main structural features of the mucupolysaccharides chitin? 2.) How do this aid in ...
A: Chitin is a carbohydrates polymer that is composed of N-acetyl glucosamine units attached together v...
Q: What is oxidative degradation in catabolism? and what is reductive biosynthesis in anabolism?
A: Anabolic reactions lead to the synthesis of biomolecules. The catabolic reactions lead to the oxidat...
Q: Table 4. Reaction of Carbohydrates with (a) Nitric acid and ; (b) /KI Sugar solution OBSERVATIUN (a)...
A: The Mucic acid test is also known as galactaric acid and is named after the reaction product that is...
Q: Differentiate direct and indirect ISE method of sodium determination. 2. What will happen to the re...
A: Sodium is an important electrolyte of blood that is analysed for checking water and electrolyte bal...
Q: Describe the strategies that could be used to design a protein that could exist.
A: Proteins are nanometer-scale molecular devices that perform biological functions. They serve as the ...
Q: What is a virus and how does the immune system kill viruses? What are the 5 examples of food that ca...
A: The science that deals with the study of viruses is called virology. Viruses are classified based on...
Q: what is the role of glutathione in digestion?
A: In process of digestion, complex molecules are converted to simple molecules with the...
Q: Trivalent and pentavalent arsenic produce different effects on cells, yet there is little distinctio...
A: Arsenic is usually associated with arsenic poisoning. Despite its toxicity arsenic has been used ben...
Q: What are the main structural features of the polysaccharides starch? How do this aids in its functio...
A: Plants store glucose as the polysaccharide starch. Starch can be separated into two fractions - amy...
Q: 1.) What nitrogenous base would not be expected in structure C? 2.) What nitrogenous base would not ...
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which o...
Q: Find the Gibbs free energy of mixing when 2 moles of ethanol is mixed with 5 moles of water at a tem...
A: Given; n1= no. of moles of ethanol= 2 mol n2= no. of moles of ethanol= 5 mol T=27oC =273+27=300K ...
Q: 4. Which of the following best describe the physical properties of fatty acids? a. All physical prop...
A: The backbone of triacylglycerols is constituted of a glycerol moiety in which all the three hydroxyl...
Q: A solution was subjected to series of test to identify what carbohydrate/s is/are present. Results w...
A: A positive (violet ring between layers) Molich test indicate the sample contains carbohydrates A pos...
Q: With reference to Table 2, what was the total extract volume in mL? Enter a number (no decimal place...
A: In cells, there are thousands of distinct proteins. Extraction and purification of these substances ...
Q: In lab two different mobile phase compositions (acetone and hexanes) were used for column chromatogr...
A: Thin layer chromatography (TLC) is a form of adsorption chromatography in which the separation of t...
Q: Mucic test is used to detect galactose in a sample as galactaric acid is formed. However, since lact...
A: Lactose is a disaccharide sugar that is composed of galactose and glucose moieties.
Q: HN-CO- HO- HO, HO ÇI HO- Но- HO- NHAC H H N „NH2 N H `N' H HN. HOOC Но Он ÓH HO OH -OH OH OH Teicopl...
A: It is a glycopeptide antibiotic produced by Actinoplanes teichomyceticus. It is made up of five majo...
Q: With the aid of a simple generic diagram: i) IDENTIFY and EXPLAIN how the type(s) of chemical bondi...
A: The downloaded image of the 3GRS structure from PDB is as shown. This is the structure of Glutathion...
Q: (i) a) Construct an empty table with the following column headings: Substrate concentration [S] and ...
A: Enzymes are usually protein molecules and catalyzes biochemical reactions without being consumed in ...
Q: Describe your first proposed step clearly in words (1-2 sentences) including the buffer/pH used. Ske...
A: Proteins are biomolecules, that is compose of amino acids linked by the peptide bonds. Each protein ...
Q: In the structure what is the difference of vancomycin and teicoplanin?
A: Teicoplanin and vancomycin are natural compounds that belong to the glycopeptide antibiotic family o...
Q: Which of the following will occur if there is an increase in enzyme or substrate concentration? in...
A: Enzymes increase the rate of biochemical reactions by decreasing the activation energy. Activation e...
Q: CH HC CH, | - Polypeptide backbone CH2 HC CH, CH - CH2¬S–5}-CH,-- OH -CH;-CH;-CHy-CH, NH," 0-ċ-CH,- ...
A: The structural organization of protein was classified into four different types and they are primary...
Q: 2. What is the general name for a monosaccharides which has A. 6 carbons B. 5 carbons C. 3 carbons
A: Monosaccharide- Simplest carbohydrates, sugar and have only 1 sugar molecule.
Q: TEST COLOR +/- Violet ring Orange solution Reddish precipitate Biuret Xanthoproteic Millon Hopkin's ...
A: The different colour reactions tells about either the presence or absence of proteins and amino acid...
Q: Explain the effect of anti acids (example MaAlOx) to the enzyme in the enzyme. How does it affect di...
A: The digestive system is one of the body’s important systems that break down the complex components o...
Q: Explain the features that generally distinguish (at least three) pathways of catabolism from pathway...
A: Catabolism is the set of reactions in the metabolic pathways that breaks down molecules into smaller...
Q: As the amount of substrate is increased in an enzyme-substrate reaction, which of the following will...
A: The enzymes are the biological catalysts, which increase the rate of a chemical reaction. The factor...
Q: How do the levels of structure achieved in proteins?
A: Proteins are classified into two types Globular proteins and fibrous proteins. Proteins have f...
Q: II. Analysis. Given below is a schematic diagram for a simple analysis of a novel tetrasaccharide is...
A: Benedict’s test: It detects reducing sugar. This test distinguishes monosaccharides and some disacch...
Q: 3.) Islandicin is a simple anthraquinone molecule. Propose a biosynthetic pathway of the compound. о...
A: Islandicin is an anthraquinone derivative molecule found in lichens and fungus like Penicillium. Thi...
Q: Which of the following is the major source of electrons that flow through the mitochondrial electron...
A: Cellular respiration refers to a process by which energy is obtained for various life processes taki...
Q: Draw a triacylglycerol containing three units of 18:3 (9,12,15).
A: Triacylglycerols are the storage lipids commonly found in adipose tissue. Adipose tissue is used to ...
Q: n a rat cardiomyocyte, the levels of creatine, phosphocreatine, and free phosphate were found to be ...
A: Gibbs's free energy is a measure of chemical energy. All chemical systems move naturally towards sta...
Q: What is the importance of Koch’s Postulate in Plant Pathology
A: The importance of Koch's postulate in plant pathology is:
Q: Find a procedure for determining phosphorus content in fertilizer other than the gravimetric method
A: The phosphorus content in fertilizers can be measured spectrophotometrically after treating the samp...
Q: Determine which of the standard amino acids have a side chain with the following characteristics. C...
A: Each amino acid has the same fundamental structure , which consists of a central carbon atom, bonded...
Q: 2. Glycosidic bond is sucrose is this answer. Explain in 2-3 sentences why you chose
A: Sucrose can be defined as a type of dissacharide. It comprises one unit of glucose and fructose resp...
Q: . Use the table of completely made-up data below to answer the following questions about a completel...
A: Enzymes catalyze the rate of conversion of Substrate into product and catalysis takes place in pocke...
hello can you explain the steps for both questions here and thanks
Step by step
Solved in 2 steps
- 1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.Remember when looking up a codon make sure it is in its mRNA form. Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create? 3.What are three differences between a point mutation and deletion mutation
- Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'1. Below is an amino acid sequence for the following strand of DNA:A G C A A T C C G T C T T G GT C G T T A G G C A G A A C CThat strand has mutated. It is nowA G C A A C C C G T C T T G GT C G T T G G G C A G A A C CUse your knowledge of mutation and protein synthesis to answer the following questions.What mutation has occurred? A. point mutation B. movement of large section of chromosome C. duplication of entire chromosome D. genetic recombination 2. Will this mutation have a real effect? Why or why not?5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
- 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
- -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTTDNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?