2.4. the second stage of cholesterol synthesis further conversion into cholesterol; formation of squalene with
Q: Consider the equilibrium of arginine below: NH₂ NH₂ H₂N: 0 NH OH H₂NE pKa-2.17 NH3 NH H₂N: pKa 9.04…
A: The proteins are constituted of 20 naturally occurring amino acids. The net charge on an amino acid…
Q: Urea is an ideal way to remove ammonia from the body because: OA) it does not affect the pH of…
A: Various metabolic processes (especially protein degradation) generates free ammonium ions. Ammonium…
Q: A. Given the following piece of messenger RNA (mRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAG…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: In the following polypeptide, which amino acid would be participating in hydrogen bonding with…
A: Alpha helix is one of the most prominent secondary structures formed by polypeptide chains. The…
Q: An aminoacyl-tRNA is initially bound to the ribosome in prokaryote at the A site on the 70S subunit…
A: A small RNA molecule known as transfer RNA (tRNA) is essential for the production of proteins.…
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ Determine the…
A: Genes are functional segments of DNA that code for particular proteins. Each gene has its unique…
Q: Synthesized proteins are processed either inside the organelles or in the cytoplasm True…
A: Proteins are the biological molecules with great diversity in structure and function. They are made…
Q: The hormone, glucagon, is released in the body when glucose levels are low. Briefly describe how…
A: In response to changes in blood glucose levels, the pancreatic cells secrete two peptide hormones:…
Q: An enzyme facilitate catalysis by formation of ester bond with an alcoholic substrate. Which amino…
A: Ester bond: The bond that is formed by the condensation of alcohol group with a carboxylic acid…
Q: c. In lab, you recorded a UV-Vis spectrum of a mixture of proteins. What best explains why two major…
A: (c). Every substance absorbs a certain amount of energy, when a light of particular intensity…
Q: UDP-glucose pyrophosphorylase catalyzes the removal of a pyrophosphate group from UTP as it…
A: In glycogen synthesis the formation of uridine diphosphate (UDP) glucose is done by UDP glucose…
Q: the acyltransferase I and II are required for: OA) transporting carnitine in the blood. B) inserting…
A: The enzymes carnitine acetyltransferase (CrAT) are a large family of enzymes that play a crucial…
Q: ✓ Part B What further experiment should be carried out in order to determine the primary structure…
A: Introduction Protein is the most abundant macromolecule in our body. Amino acids are the building…
Q: The Krebs cycle reaction shown below is catalyzed by __ enzyme and ___ pays for this reaction note…
A: The TCA cycle or Kreb cycle occurs in the mitochondrial matrix. The TCA cycle uses the acetate in…
Q: Briefly describe why mammals can not convert fatty acids to carbohydrates? Why plants can do so?…
A: Lifeforms are more or less a controlled and well regulated chemical lab in themselves. A whole lot…
Q: 1. Discuss the 2 mechanisms by which Chloride maintains electrical neutrality.
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: FoF1 ATPase is the enzyme that catalyzes ATP synthesis. The enzyme itself is deactivated. ATP. What…
A: Enzymes are biological catalyst that speed up biochemical reactions. Activity of enzymes refers to…
Q: Choose the correct path taken by a pair of electrons as they travel down the electron-transport…
A: Electron transport chain consists of a group of protein complexes in the mitochondrial membrane…
Q: Which of the following is not a characteristic of DNA replication? O The synthesis of DNA is…
A: DNA carries all the genetic information needed to make an organism. DNA contains genes which are the…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: explain the following prperties of G protein: structure of G- activation cycle and signaling pathway…
A: G proteins are the Guanine nucleotide binding proteins which functions in transducing signals…
Q: what are the features which set the G protein family of receptors apart?
A: G protein-coupled receptors (GPCRs) are regarded as one of the most extensive families of validated…
Q: An enzyme facilitate catalysis by formation of phosphoester bond with the phosphate group of the…
A: Enzymes are biomolecules which facilitate key biochemical reactions by acting as catalysts. The…
Q: Question 22 Which is not a structural motif for DNA binding? αβα motif Zn Finger leucine zipper…
A: Proteins are true polymers, which are composed of amino acid units. Proteins have four levels of…
Q: Part A. Weight of skimmed milk Isolation of Casein Weight of dried casein Percentage casein in…
A: Since you have posted multiple questions, we will provide the solution only to the specified sub…
Q: Provide other techniques which can be used to characterize DNA extracts. Provide advantages and…
A: DNA extracts characterization is done by many methods. It is done to check purity, stability,…
Q: Use dAMP and dTMP to draw the two monomers together
A: Nucleotides are structural components of nucleic acids (DNA or RNA). Nucleotides are composed of a…
Q: Many metabolites are transported either actively or passively across mitochondrial outer and inner…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: what is bioenergetics ?
A: The scientific field of biochemistry focuses on all the chemical and biological processes involved…
Q: Indicate whether each of the following is due to an increase in pH, a decrease in pH or neither and…
A: pH is defined as the measure of acidity or basicity of a solution. In general, pH is inverse…
Q: Determine the amount of glucose in the unknown sample by plotting a standard curve of Absorbance at…
A: Here we are conducting an assay to determine the amount of glucose in an unknown sample. For this,…
Q: Which of the following is not true? A.) A single activating enzyme can interact with all the tRNAs…
A: The 'activating enzyme' mentioned in option 1 is aminoacyl tRNA synthetase. Aminoacyl tRNA…
Q: how does high pressure O2 treat CO poisoning?
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: Calculate the more fraction of HC! hydrochloric water containing 30% HCl and water in a folution…
A: Mole fraction is a fraction of the number of moles of a particular component in a mixture divided by…
Q: A patient was admitted to the hospital with suspicion of malaria. After the examination was complete…
A: Glucose-6-phosphate dehydrogenase (G6PD) is an enzyme involved in pentose phosphate pathway. Malaria…
Q: Which of the following tripeptides has a net charge of +1 at pH 8? O SIT OPEN OAKT DIG OWTG
A: Peptides are made up of amino acids. Every amino acid have an alpha-carbon that is bonded to 4…
Q: The enzyme that decarboxylates pyruvate before it gets converted to Acetyl CoA is a. Pyruvate…
A: Citric acid cycle is a metabolic pathway that converts carbon atoms to CO2 and, in doing so,…
Q: Name : Surname: 2. The amino acid side chain residues in an a helix point center of the helix. A)…
A: The proteins consist of 20 naturally occurring amino acids. The proteins must fold into the proper…
Q: Question 3 A 50 kDa protein has a minimum radius 2.4nm, while a 20 kDa protein has a minimum radius…
A: 3 Answer the NPC would not allow proteins with a radius >2.5 nm to pass through freely,…
Q: myristic acid (14:0) to carbon dioxide and water a. rounds of the beta oxidation pathway will be…
A: Beta oxidation is a collection of 4 enzymatically catalysed reactions that cleave 2 carbon at a time…
Q: Provide a simple sketch of the covalent intermediate likely to form between active site serine…
A: Serine, histidine, and aspartate all are amino acids. They all have different properties and…
Q: Which of the following is activated after epinephrine/ glucagon binds to their receptores select all…
A: Glucagon and epinephrine are hormones that increase the blood glucose levels. So all those processes…
Q: 4 Using the structures you drew in questions 2 & 3, for each of the organic functional groups listed…
A: The structures of the compounds from questions 2 and 3 are given below (lecithin) The…
Q: TRUE OR FALSE 1. Carboxybiotin is covalently linked to an enzyme via E- amino group of a lysine…
A: An enzyme is a substance that acts as a catalyst in the living systems. It increases the rate of…
Q: 2. Look at the diagrams below and indicated if the evidence came from the victim or suspect in…
A: DNA carries genetic information in most of the cells. DNA is a type of nucleic acid which has a…
Q: O2 is a competitive inhibitor of the hydrogenase enzyme that catalyzes the conversion between…
A: A competitive inhibitor is a type of inhibition in which a inhibitor, binds to the active site of…
Q: Describe how each of the following relates to protein configuration: primary structure - secondary…
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: You have purified a recombinant form of the p53 protein from E. coli and determined the A280 to be…
A: Beers law states that the absorbance of a sample depends on the amount of sample present and path…
Q: . a. Explain why the melting point of palmitic acid (16 carbons, no double bonds) is slightly lower…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: ATP is the primary source of cellular energy. What qualities of ATP make it a useful energy…
A: ATP acts as the “energy currency” of the cell. The energy that is released during fuel oxidation in…
Step by step
Solved in 2 steps with 1 images
- Which of thse molecules is most reduced? Which is most oxidized? CH4, COH4, COH2, or CO2H25. Mutual intermediates of catabolism of proteins, carbohydrates and lipids; their role in the integration of cellular metabolism.The Krebs cycle converts ________ through a cycle of reactions. In the process, ATP, ________, and ________ are produced. acetyl CoA; FAD, NAD acetyl CoA; FADH2; NADH pyruvate; NAD; FADH2 pyruvate; oxygen; oxaloacetate
- Understanding the Mechanism of Hemolytic Anemia Genetic defects in glycolytic enzymes can have serious consequences for humans For example, defects in the gene for pyruvate kinase can result in a condition known as hemolytic anemia. Consult a reference to learn about hemolytic anemia, and discuss why such genetic defects lead to this condition.Glycolysis results in the production of two ________ molecules from a single molecule of glucose. In the absence of ________, the end product of glycolysis is ________. acetyl CoA, pyruvate, lactate ATP, carbon, pyruvate pyruvate, oxygen, lactate pyruvate, carbon, acetyl CoAConsider the synthesis and degradation of tyrosine as shown in Figures 25.37, 25.38, and 25.48 to determine where the carbon atoms in PEP and erythrose-4-P would end up in acetoacetate and fumarate.
- Which pathway produces the most ATP molecules? lactic acid fermentation the Krebs cycle the electron transport chain glycolysisAcyl-CoA synthase is the enzyme that activates a fatty acid by converting it to a fatty acyl-CoA (Section 24.5) in a series of two reactions. In the firstreaction, the fatty acid reacts with ATP and one of the products formed is ADP. The other product reacts in a second reaction with CoASH to form thefatty acyl-CoA. Propose a mechanism for each of the reactions.Years ago there was interest in using uncouplers such as dinitrophenol asweight control agents. Presumably, fat could be oxidized without concomitant ATP synthesis for re-formation of fat or carbohydrate. Why was this a bad (i.e., fatal) idea?
- Glucose is completely metabolized to six molecules of CO 2. What specifi c reactions generate each molecule of CO 2?To prevent tooth decay, nutritionists recommend replacing sucrose in kindergartens with non-carbohydrate sweeteners. Q: write the reaction of dissociation of the final product of this metabolic pathway, causing a shift in pH in the oral cavityAdults who participate in vigourous physical exercise need around 160 g of carbohydrate per day but just approximately 20 mg of niacin for good nutrition. How do you interpret the finding in light of niacin's involvement in glycolysis?
