23. The parts lateral to the point are the... a. Internal nares b. Eye bulges c. Eustachian tube opening d. Glottis

Q: A DNA fingerprint is based on _____. a repeating sequences found on noncoding regions b the…

A: DNA fingerprinting is commonly employed in investigations to connect evidence with suspects, but DNA…

Q: Explain the evidence that our species originated in Africa.

A: Introduction :- A species is commonly defined as a collection of organisms that can reproduce…

Q: In guinea pigs, rough coat is dominant (R) to smooth coat (r), and black coat (B) is dominant to…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: True or False: 1. In DNAs, the amount of adenines always equal to the amount of thymine and…

A: DNA It is a nucleic acid molecule which constitutes two polynucleotide chains wound around each…

Q: The prime source of chlorofluorocarbons is A. Vehicular emissions B. Industrial effluents C.…

A: Introduction - Fully or partially halogenated hydrocarbons containing carbon, hydrogen, chlorine,…

Q: What functional assays did Kazutoshi Takahasi and Shinya Yamanaka use to show that induced…

A: Kazutoshi Takahashi and Shinya Yamanaka modified mouse fibroblast cells that are able to synthesize…

Q: III. Give at least 3 diluting fluids that can be used for WBC count.

A: Lymphocytes (WBCs) are found in lymph nodes and aid in the destruction of invading germs and other…

Q: Procedure: 1. Use the figure to answer the following question. Which of the parent birds shown below…

A: Introduction Natural selection is an evolutionary mechanism. Organisms that are better adapted to…

Q: Discuss the societal impacts of the use of transgenic Golden Rice. What are some potential benefits…

A: INTRODUCTION A genetically modified organism is a living organism whose DNA has been altered via the…

Q: Name the different components (a-g) and functions of the Ebola virus shown below. Please write the…

A:

Q: Cell membranes can maintain a difference in electrical charge between the inte- rior of the cell and…

A: Introduction The plasma membrane or cell membrane is the outer layer of all cells, however it is…

Q: A histological specimen of spleen shows a vessel with a wall consisting of endothelium and…

A: Introduction :- A part of the lymphatic system, the spleen is an organ. The spleen is responsible…

Q: explain in not more than 350 words how the structure of glycogen makes it ideal as a fuel storage…

A: Glycogen is a glucose polymer that is used to store energy in mammals. The predominant storage type…

Q: Why are false-negative results usually more common than false-positive results in biochemical and…

A: A false-positive result is a result which is interpreted as true but it is, in reality, false. The…

Q: Which of the following characteristics does not describe DNA? a contains thymine b contains uracil…

A: DNA contain :  Adenine, thymine, cytosine and guanine.  DNA present in the nucleus.  Nucleus has…

Q: Consider a transition of X → y. assume that the only difference between X and y is the presence of…

A: Introduction Equilibrium is a condition of equilibrium or a stable situation in which opposing…

Q: 13. A way we can measure the health of an ecosystem is to look at the change in number of species…

A: Answer

Q: Cell membranes can maintain a difference in electrical charge between the inte- rior of the cell and…

A: Action potential means the rapid rise or fall in membrane potential across a cell membrane. Action…

Q: Which type of point mutation does not affect the resulting protein? a deletion b missense mutation…

A: A mutation is any alteration or change in the sequence of the genetic material (DNA or RNA). A point…

Q: What information can be obtained from DIS80 primer Blast ? A Respect length and number in alleles…

A: Primer-BLAST used for design a new target-specific primers in one step . Primer BLAST check the…

Q: Membrane proteins perform the following functions EXCEPT one. Which One?

A: This question is based on function of membrane protein.

Q: Order the path of light through the eye.   Question 68 options:   retina   lens   cornea…

A: The path of light through the eye begins with the objects viewed and how they produce, reflect or…

Q: comparison of the worms' body structures:

A: Platyhelminthes also called flatworm.  They are the  group of soft-bodied, usually much flattened…

Q: Which type of mutation involves only one base pair? a. insertion b. deletion c. inversion d.…

A: A mutation occurs when DNA molecules are copied or replicated, resulting in DNA variants that can be…

Q: role of the nervous system and genes in intellectual disability?

A: Nervous system is one of the most important system in living organisms among all other systems, it…

Q: Question 1. Which of the following is never found in prokaryotes? A. Ribosomes B. DNA Polymerases C.…

A: Introduction :- Ribosomes, also known as Palade granules, are macromolecular machines that perform…

Q: Margarine is made from vegetable oil by a chem-ical process. Do you suppose this process converts…

A: Margarine is a flavouring, baking, and cooking spreading. It's most commonly used as a butter…

Q: How is the photic energy absorbed by chlorophyll transfered to ATP molecules in…

A: Photons of light energise the electrons in the chlorophyll molecule. The electrons are attracted by…

Q: A G- H В C F A B E Guy/99 Livingstone BIODIDAC Livingstone O BIODIDAC Figure 2. Frog's Internal…

A: Humans and frogs share comparable neurological, circulatory, digestive, and breathing systems. Both…

Q: Cancer cells were characterized for their high transcriptional and translational levels. Direct…

A: Transcription factor – a material, such as a protein, that contributes to the purpose of a specific…

Q: a. We have a molecule 2,3-bisphosphoglycerate (BPG), which is a negative allosteric modulator for…

A: In the below picture I have attached the reaction equilibrium between Hb and Hb:BPG and how it…

Q: Give an example of each of the following types of viruses a. Double stranded DNA b. Single stranded…

A: Viruses are intracellular, obligately parasitic, non-cellular, sub-microscopic organisms that…

Q: Each DNA sequence that can serve as an origin of replication is found to contain a binding site for…

A: On a chromosome or a plasmid, an origin of replication can be referred to as a stretch of DNA where…

Q: Which statement describes the most likely outcome for the owl and toad populations in an environment…

A: skyglow causesthe owl population to experience a decrease in hunting success it can be explained by…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Chemiosmosis

A:

Q: Match the male structures with their descriptions.     a collection of tissues that allows for…

A: 1) Testes: Tissue that house many cell types that are responsible for sperm manufacture and sex…

Q: two types of xenobiotic protection ( Toxicokinetically and toxicodynamically)

A: Xenobiotics are chemicals to which an inoculum is exposed that are not intrinsic to the organism's…

Q: Fermentation involves the use of organic compounds as electron acceptors. True O False

A: Respiration produces the energy currency of the cells, ATP. ATP production takes place in the…

Q: What is the Process/Mechanism involved in the left atrium of a frog. What is the function of organ…

A: A frog is a member of the order Anura, which consists of a diversified and primarily predatory…

Q: Viruses with reverse transcriptase enzyme can make a DNA copy out of its RNA genome.  What…

A: Reverse transcriptase (RT) It is an enzyme through a single-stranded RNA transcribes into the DNA.…

Q: Colonies that produce alkaline waste on Hektoen enteric agar will turn O blue-green. O pink. O…

A: Colonies that produce alkaline waste on Hektoen enteric agar will turn blue- green.

Q: Which of the following characteristics does not describe RNA? a. contains uracil b. is…

A: The ribonucleic acid, complex compound of high atomic weight that functions in cell protein…

Q: 5) Briefly explain why the formation of a tumour can pose a risk to a person's homeostasis.

A: Cancer is a condition in which cells proliferate abnormally and infiltrate, erode, and kill healthy…

Q: Identify adaptations that have contributed to pathogen success.

A: Introduction :- Plant and animal diseases can be infectious or non-infectious. We'll concentrate on…

Q: If American cacti and African spurges were closely related, could they be used to show that…

A: Introduction Evolution is the process of a species' features changing over numerous generations…

Q: Question 3 Which of the following statements about T-1 antigens is FALSE They require T cell help…

A: Thymus independent antigens (TI -1 ) are those antigens  which possess the ability of activation of…

Q: How can the hypothesis that asserts that chloroplasts as well as mitochondria were primitive…

A: Introduction - A chloroplast is a type of organelle found in the cells of plants and algae that is…

Q: Select the barriers that contribute the difficulty of treating intracellular gram-negative bacterial…

A: Gram-negative bacteria's cell membrane is made up of 2 layers, the inner and outer membranes,…

Q: Below is the oxygen saturation curve for myoglobin and hemoglobin at a pH of 7. The p50 for…

A: The shape of oxygen dissociation curve for Hb is sigmoidal. The shape of oxygen dissociation curve…