3. Identify key flower structures and describe differences between flower and pollenstructures in monocots and dicots.4. Explain what is meant by alternation of generations, sporophyte and gametophyte.5. Describe how male and female reproductive cells are produced in angiosperms and theprocess of double fertilization.000000

Flowers are the reproductive portions of the plant, their fundamental function is reproduction. Many…

Answered: 3. Identify key flower structures and…

3. Identify key flower structures and describe differences between flower and pollen structures in monocots and dicots. (no o) aliso

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter27: Reproduction And Development Of Flowering Plants

Section: Chapter Questions

Problem 4SA: In flowers, the structures that produce male gametophytes are called _______ ;the strcutures that...

See similar textbooks

Related questions

Q: Natural selection occurs when which of the following conditions are met? Individual organisms…

A: Natural selection can be referred to as the method by which the most well-adapted forms of living…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: (a)What are the two superfamilies of proteins in which amylase is categorized? (b)To which…

A: Proteins are made up of amino acids that are linked together by peptides. Along with the R side…

Q: Compare the bodies of an Old World monkey, a New Worldmonkey, and an ape, giving examples of each.

A: Callitrichidae, Cebidae, Aotidae, Pitheciidae, and Atelidae are the five primate families that make…

Q: After a positive strand RNA virus ( Such as Coronaviruses) enters the host cell, the RNA is…

Q: Explain the process of polyacrylamide reaction, and what are the two reagents are crucial for this…

A: Polyacrylamide is defined as a mesh like matrix that is suitable for the separation of proteins of…

Q: Can (1) chain and (2) ring structural abberations still lead to fertile gametes? explain

A: Abberations indicates the genetic material which should be DNA . The DNA transfer the information…

Q: Compare and contrast both the structure, AND the molecular mechanisms of the Moderna/Pfizer Covid-19…

A: The Pfizer-BioNTech vaccine (brand name: Comirnaty) was granted full Food and Drug Administration…

Q: Hello! Talk about the lecanemab and solanezumab treatments towards Alzheimer's diseases. It is…

A: Alzheimer's disease- is a neurodegenerative disease that has a slow start and worsens progressively.…

Q: All the body systems work together to maintain homeostasis in the organism. No organ system operates…

A: Introduction :- Large insoluble food molecules are broken down into small water-soluble food…

Q: help me answer questions 91, 99, and 100 91. Which of the following are the prinmary components of…

Q: Why do you also perform analysis on food that is verified to be a non-GMO food?

A: The term GMO refers to a genetically modified organism. Transgenic techniques are accessible since…

Q: Female Drosophila with cinnabar eye (cn) and vestigal wings (vg) were mated to males with roof wings…

A: The genes present on the same chromosome cannot assort rather they tend to be inherited together.…

Q: how does hamilton's rule predict what's going on? 2. can kin selection explain eusociality?

Q: What is a DNA Ladder?

A: Answer :: 1) DNA or deoxyribonucleic acid is the molecule that contains genetic code of organisms.…

Q: hat features of molluscs appear in other invertebrate phyla? Explain

A: The most common properties of mollusks are covers with various vital openings used for breathing and…

Q: SARS-CoV-2 spreads through cell-to-cell transmission

A: Introduction Covid 19 is a coronavirus-caused acute respiratory infection in humans that can cause…

Q: In which era of the Geologic Time Scale are we currently living ir O Cenozoic O Mesozoic

A: 2nd answer is cenozoic

Q: Which of the following agents (yeast, bacteria, and molds) do you think should be utilized to…

A: Yeast is a single-celled creature known as Saccharomyces cerevisiae that requires food, heat, and…

Q: Which enzyme is responsible for proofreading nucleotides during DNA replication? a nuclease b…

A: Transmission of DNA or genetic material is very crucial to propagate gene from parent to offspring.…

Q: Each DNA sequence that can serve as an origin of replication is found to contain a binding site for…

A: On a chromosome or a plasmid, an origin of replication can be referred to as a stretch of DNA where…

Q: A resting human hydrolyzes about 40 kg of aTP every 24 hours. The oxidation of how much glucose…

A: ATP stands for Adenosine 5'-triphosphate is a molecule that stores and provide energy to ask the…

Q: In guinea pigs, rough coat is dominant (R) to smooth coat (r), and black coat (B) is dominant to…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Dihybrid Crosses - Problem 1 I IHINK WE WERE IN THE BATH TOR TO0 LONGI WE'LL STICK WITH PEAS FOR THE…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Which enzyme is required for the movement in DNA-only transposons? Group of answer choices Reverse…

A: In early 1970s, a number of researchers including Peter Starlinger and James Shapiro, independently…

Q: Please help me answer questions 82 & 84. 82. Asexual reproduction differs from sexual reproduction…

A: The reproduction is the characteristics of living organisms that is responsible for increasing the…

Q: 23. The parts lateral to the point are the... a. Internal nares b. Eye bulges c. Eustachian tube…

A: The anatomy is the study of different structures present in the body.

Q: (a) what are the advantages of using computer simulations over tangible models? (b) what are the…

A: Introduction According to this biological model, protein molecules are embedded in a lipid bilayer…

Q: Choose a specific process in food businesses that allow them to get rid of/prevent the growth of…

A: Food preservation procedures include those that limit the growth of germs like yeasts (although…

Q: True or False: 1. All functional transcripts have been initiated, elongated and terminated with…

A: False : post transcription events include splicing, capping, tailing. Initiation is the beginning of…

Q: Fermentation involves the use of organic compounds as electron acceptors. True O False

A: Respiration produces the energy currency of the cells, ATP. ATP production takes place in the…

Q: Select all that are true about DNA gel electrophoresis O This technique can be used to separate DNA…

A: The gel electrophoresis is routinely used technique in molecular biology laboratories that helps in…

Q: what is/are the importance of the sense and missense/antisense strands and 2. what are the…

Q: Penicillin obtained from a fungus is : A. Antibiotic B. Antiseptic C. Antibody D. Antiserum

A: Introduction - Medicine is the science and practise of caring for a patient, including diagnosing,…

Q: Homo floresiensis fossils were discovered in_____ . a. Australia c. Indonesia b. China d. South…

A: The discovery of Homo floresiensis was largely unexpected, as most previous evidence suggested that…

Q: Restriction maps illustrate the lengths of DNA fragments between restriction sites. Which of the…

A: Restriction mapping is a technique to map unknown segment of DNA by breakung it into small…

Q: Which of the following enables ions such as sodium to cross a plasma membrane? A. phospholipid…

A: Plasma membrane It is a semipermeable membrane made up of proteins, phospholipids, carbohydrates…

Q: A more hygienic environment in our modern society A. has increased the overall prevalence of…

A: By the exposure of the information in the whole world the awareness towards self hygiene has…

Q: Distinguish between the main groups of archaea and identify specific types of archaea belonging to…

A: Archaebacteria are the oldest living organisms belonging to kingdom Monera and are classified as…

Q: explain how p53 functions in a cell that sustained DNA damage to prevent progression of that cell…

A: p53 induces numerous different target genes and blocks the different stages of progression of tumor…

Q: 1. Explain why the homologous structures in part I are evidence of evolutionary relationships.

A: The figures that are shown in Part I are structures of homologous organs. These are the structure of…

Q: O 500 animals O 610 animals O 450 animals O Not yet at K O 200 animals

A: In biology, growth curves are commonly used to represent things like population size or biomass, as…

Q: The standard clotting/coagulation screen (PT, APTT, fibrinogen) and platelet count is the most used…

A: The prothrombin time (PT) test measures how well and how long it takes your blood to clot. It…

Q: What changes can be made to an mRNA transcript to be used in a vaccine in order to change its…

A: mRNA is basically composed of protein encoding ORF, surrounded by 5′ and 3′ UTRs, and a 7-methyl…

Q: Question 3. Which amino acid is most likely to be found in the hydrophobic core of a protein? A.…

A: Please follow step 2 for detailed explanation.

Q: three different types of loss of function mutations and in each case explain how the mutation exerts…

A: A mutation is any alteration of the base sequence of the DNA or RNA. Since mutation alters the base…

Q: 2. Hemoglobin releases protons upon oxygen binding. This phenomenon is called the Bohr effect, and…

A: Introduction Hemoglobin, often known as Hb or Hgb, is an iron-containing oxygen-transport…

Q: Which technology for studying genes do researchers use to attempt to insert genes into the DNA of…

A: ANSWER;- c)gene therapy Explain;- The main strand is the least difficult to imitate. When the DNA…

Q: what is the extraction of the causal organism from inoculated host?

A: Robert Koch (1843 - 1910) was a famous biologist who made bacteriology an important science. He is…

Q: Explain the underlying cause of inborn errors of metabolism (a diagram can be used to illustrate…

A: Inborn errors of metabolism are metabolic disorders which occurs due to the genetic disorders which…

Concept explainers

Angiosperm Reproduction

The process of sexual reproduction in flowering plants is known as angiosperm reproduction. In flowering plants, reproduction begins with pollination, or the transfer of male gametes (pollen) from the male reproductive organ (anther) to the female reproductive organ (pistil), and ends with fertilization of the female gametes (egg), which produces a zygote, which then grows to become a mature plant.

Question

3. Identify key flower structures and describe differences between flower and pollen
structures in monocots and dicots.
4. Explain what is meant by alternation of generations, sporophyte and gametophyte.
5. Describe how male and female reproductive cells are produced in angiosperms and the
process of double fertilization.
000000

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Explain the sequence of events in a flowering plant that begins with formation of a pollen tube and culminates with the formation of a diploid zygote and the 3n cell that will give rise to endosperm in a seed.
Corn develops from a seedling with a single cotyledon, displays parallel veins on its leaves, and produces monosulcate pollen. It is most likely: a gymnosperm a monocot a eudicot a basal angiosperm
After double fertilization: a zygote and ______ form. an ovule endosperm a cotyledon asuspensor
Which of the following statements is false? a. Auxin and gibberellin promote stem elongation. b. Cytokinin promotes cell division in shoot tips. c. Abscisic acid promotes water loss and dormancy d. Ethylene promotes fruit ripening and abscission.
Corn develops from a seedling with a single cotyledon, displays parallel veins on its leaves, and produces monosulcate pollen. It is most likely: a. a gymnosperm b. a monocot c. a eudicot d. a basal angiosperm
The three main parts of a mature seed are _________ a. pollen grain, egg, and seed coat b. embryo, endosperm, and seed coat c. megaspores, microspores, and ovule
In flowers, the structures that produce male gametophytes are called _______ ;the strcutures that produce female gametophytes are called _______ . a. pollen grains; flowers c. anthers; stigma b. stamen; carpels d. megaspores; microspores
Adaptations that correlate with the adaptive success of angiosperms include: a. seeds borne on cones. b. protection of the ovule inside an ovary. c. seed dispersal by way of fruits. d. coevolution with animals that pollinate flowers. e. nourishment of developing embryos by tissues of the femalegametophyte.
Which of the following traits characterizes gymnosperms? a. The plants carry exposed seeds on modified leaves. b. Reproductive structures are located in a flower. c. After fertilization, the ovary thickens and forms a fruit. d. The gametophyte is longest phase of the life cycle.
1. Explain the process of seed development in a typical angiosperm plant. 2. Describe the two -stage life cycle of plants: the gametophyte stage and the sporophyte stage. 3. A cross section through the blade of a typical dicot leaf reveals distinct tissue layers. What are these? Differentiate briefly each layer.
5. Using the illustrations above, arrange the following statements to explain the process of pollen formation in angiosperms. (Microsporogenesis) A. A diploid sporogenous cells differentiate as microsporocytes (pollen mother cells or meiocytes) which divide by meiosis to form four haploid nucleus. B. Distinct single-celled haploid microspores form after cytokinesis.
1. Plants are classified into three types based on water availability in its habitat. What are these types? Cite at least one leaf adaptation (morphological /anatomical) on each type. 2. Explain the process of seed development in a typical angiosperm plant. 3. Describe the two -stage life cycle of plants: the gametophyte stage and the sporophyte stage.