4. Write the Edman degradation technique used for the sequencing of proteins 5. A helix contains 308 residues (AA) in its chain. Find the number of helical turns and the vertical height of the helix. 6. Explain the various forces exist and control the tertiary structure of protein.
Q: (5) You have discovered a brand-new protein and need to determine its tertiary (and possibly…
A: Proteins are composed of polypeptide chain that can shows different three dimensional structures.…
Q: 1- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G] = [C], equalities…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: . Determine how many amino acids will appear on the protein encoded in a DNA segment that contains…
A: 2. DNA SEGMENT CONTAINS = 981 NUCLEOTIDE UNITS. on transcription of DNA segment which contains 981…
Q: 5) List the names of the 5 different base pairs and their letter code. Identify if they are…
A: A base pair is a fundamental unit of double-stranded nucleic acids consisting of two nucleobases…
Q: (i) Draw the structure of the RNA dinucleotide TG. (ii) What is the charge on this RNA dinucleotide…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: SDS-poly- acrylamide slab Protein spot Two-dimensional gel electrophoresis is used to separate and…
A: Gel electrophoresis is a method employed for isolating DNA fragments or proteins based on their…
Q: 1. Which of the following rules apply to the synthesis of nucleic acids? A. Nucleotides are added to…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Discuss the reasons proteins were generally favored over DNA as the genetic material before 1940.…
A: DNA and RNA are considered as a genetic material. DNA is inherited or transferred from parents to…
Q: Consider the equation below. What are its consequences in the context of an electrophoresis…
A: Electrophoresis is a technique used in laboratories to separate DNA, RNA, and protein molecules…
Q: List 4 key differences between the alpha-helix and beta sheet forms of the secondary structure.
A: The proteins consist of a level of structural organization that includes a primary, secondary,…
Q: 1. Explain why the primary structure sequence -Lys-Leu-Trp-Asp- may promote a-helix formation while…
A: The formation of α helix is occurred due to attachment of H of N of Cα of first (n) amino acid to…
Q: 1)What is the objective of hydrolyzing the RNA prior to doing biochemical tests? 2) What particular…
A: Asked : Objective of RNA hydrolysis Test for pentose except Molisch's RNA and DNA questions are…
Q: What is the name of the method you used to isolate protein from bacterial samples?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1. Based on the results obtained give the differences between the hydrolyzed and unhydrolyzed RNA.
A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…
Q: 8. Explain how to prepare 3 ml of a solution with a concentration of 2ug/5ml from a stock solution…
A: For the preparation of this solution from a concentrated stock solution the formula V1 x S1 = V2 x…
Q: 1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA…
A: Deoxyribonucleic acid DNA isolation is referred to the extraction process of DNA from different…
Q: Name three parts of nucleotide 5. Name nitrogenous bases found in DNA and RNA 6. Discuss on the…
A: Since you have asked multiple questions, only the first three questions have been answered. Please…
Q: 1.Calculate the average number of nucleotide pair per micrometer of DNA double helix using the…
A: James D. Watson and Francis H. Crick suggested the three-dimensional structure of DNA for the first…
Q: Gel electrophoresis separates nucleic acids on the basis of differences in (a) length (molecular…
A: Nucleic acids, DNA and RNA, are composed of monomers termed nucleotides. A nucleotide is composed of…
Q: 1. Suppose Biuret test is conducted to a solution of RNA. Will it give a positive result or not?…
A: The Biuret test is a chemical test used for confirming the presence of peptide bond. Molisch's test…
Q: 3. For this short DNA segment, a. identify the 5' end and the 3' end of the molecule. b. circle the…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1. Name and write the structures of the purine and pyrimidine bases present in DNA. 2. What bonds…
A: DNA or deoxyribonucleic acid contains all the instructions in the form of bases/ codons that an…
Q: 4. A polypeptide comprised of 17 amino acid res- idues with the sequence on the right is ob-served…
A: The peptide sequence using 3 letter amino acid code is given below.…
Q: 2. Can a strong alkali such as NaOH be used to bring about the hydrolysis of RNA? If YES, what are…
A:
Q: 1. What are the three general steps involved in isolation of proteins? Discuss or briefly describe…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What is the chemic name and formula of the precipitate for the test for phosphate? 2.suppose biuret…
A: Dear students, As the given question has multiple questions and here it is not specified which…
Q: Discuss the differences between the Z-Form, A-form and B-form Dna
A: DNA (Deoxyribonucleic acid) is a molecule which is present in the nucleus of the cell. It contains…
Q: 0.175mm e O In the DNA extraction experiment, the separation of DNA from its packaging protein can…
A: Introduction DNA is crucial biomolecule which serves as genetic material in most of the living…
Q: 1. For this oligonucleotide, • dassify if RNA or DNA? Justify your choice. • determine the sequence…
A: Deoxy ribose nucleic acid or DNA has a Ribose sugar with deoxy hydroxyl group at 2'carbon. Ribose…
Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…
A: Codons are the mRNA triplet nucleotides and are the coding sequences. They are translated to form a…
Q: 5. Based on the following gel, what is the size of the band B in lane 2? 5.0 4.0 3.0 2.0 1.5 1.0 0.5…
A: The method of gel electrophoresis is used to separate DNA fragments based on their size.DNA samples…
Q: 1. How many individual proteins do you have if you are able to purify 350 ng of a 267 amino acid…
A: Protein is a nitrogenous organic macromolecule that is necessary for human health. It is responsible…
Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show…
A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is…
Q: 1. What is the function of each step or reagent used in the isolation of casein from milk?…
A: Casein is an important protein that can be isolated from milk for usage in nutritional supplement…
Q: 2. In the given segment in problem 1, illustrate and indicate the direction of synthesis of: a.…
A: The replication process begins with the unwinding of the polynucleotide strand, which forms a…
Q: 1. The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 D. In your…
A: DNA (deoxyribonucleic acid) is a double helix structure that is made up of two intertwined…
Q: 1) The Qiagen DNeasy DNA extraction kit is used to extract DNA from a liver cell line for subsequent…
A: DNA extraction aids in the study of the genetic origins of different illnesses. For the development…
Q: What can we most-accurately say about the polypeptide with the primary sequence KNEADING? a.It has…
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…
Q: 1. Suppose a protein sample with a fragment containing the following amino acid sequence is…
A: Biological macro-molecules are constituted of nucleic acids proteins lipids and carbohydrates.
Q: Draw these phosphorylated structures as they would be connected in a polinucleotide (e.g.RNA) in the…
A: RNA is a nucleic acid that contains ribose, a nitrogenous base (A, G, C, and U), and phosphate…
Q: 1) What is the purpose of hydrolyzing the RNA before conducting biochemical tests?
A: RNA or Ribonucleic acid is a complex compound that is polymeric and helps in the coding, decoding…
Q: 22. Which of the following mutations would be expected to have the most harmful effect on the…
A: Mutations Mutations are defined as any change or alteration in the base sequences of the DNA further…
Q: 2, Please answer the following questions pertaining to nucleotides. A. (You can answer part (A) and…
A: The material which is transferred from the preceding generation to the succeeding generations is the…
Q: 1. What is the purpose of hydrolyzing the RNA before conducting biochemical tests? 2. Enumerate…
A: Hi, thank you for posting the question on Bartleby. As per the guidelines, we can answer only one…
Q: 2. A. Proteins stick to DNA through hydrogen bonds. Draw your choice of a correctly hydrogen bonded…
A: Hydrogen bonds are one most most frequently seen chemical bonds in biomolecules , whether it be in…
Q: 1. What does Chargaff’s rules mean? 2. What are the two types of nucleic acids, and what are their…
A: Molecular molecules that carry information in cells are known as nucleic acids. Nucleic acids are…
Q: Protein sequences are usually more advantageous than DNA sequence in the comparative pairwise…
A: Pairwise analysis of sequences helps in finding out the similar regions in the given set of two…
Q: 1) Describe one inner and one outer approach for the prediction of contact or distance maps in…
A: Protein structure prediction is the process to identify the 3-D (dimensional) structure of a protein…
Q: 5. A nucleotide is the building block for a specific biomolecule. It is made up of a pentose sugar,…
A: DNA contains the gene which are the units of hereditary. This DNA is present inside the nucleus as…
Step by step
Solved in 3 steps with 3 images
- 1)What is the objective of hydrolyzing the RNA prior to doing biochemical tests? 2) What particular test, other than Molisch's, may be performed to determine the presence of pentose sugar? Create a process. 3) List the sugars, purines, and pyrimidine bases found in DNA and RNA and write down their structural formulae.1. What is the purpose of hydrolyzing the RNA before conducting biochemical tests? 2. Enumerate the sugar component, purine, and pyrimidine bases present in DNA and RNA and write their structural formulas1.Draw these phosphorylated structures as they would be connected in a polinucleotide (e.g.RNA) in the order A-B. / Show how they combine to form the polynuleotide (i.e. only the end product). Show at any one of these structures where the glycosidic bond occurs 2.Sanger sequencing revealed the sequence of an oligonucleotide to be: d-AGATGCCTGACT. Draw a diagram of the gel banding pattern post capillary electrophoresis i.e. where on the gel would the fragments feature
- 1- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G] = [C], equalities now called Chargaff’s rule. With the use of this rule, determine the percentages of all the bases in a DNA molecule which contains 35% thymine. Explain. 2- Similar equalities (i.e. [A]=[U] and [G]=[C]) are however not observed in RNA molecules. Explain the structural differences which dictate why Chargaff rule does not apply to RNA polynucleotides.1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA sample is below 1.8 A260/A280 so, where did the proteincontamination come from? Note: Cite the in-text citation and referencesIn the given segment 3 ’ C A G T T A C G G C T C C T A G G T T A T A A T T C G T T T C 5 ’ Illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragment
- 1. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. ATG GCA TGC AAT AGC TCA TGC 2. What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A?6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?1. Suppose a protein sample with a fragment containing the following amino acid sequence is subjected to various chemical assay/tests. - Ala-Gly-Trp-Phe-Met-Cys- What is observed when the protein sample is subjected to Millon’s test? Violet interface Red precipitate/solution Brown/black precipitate Yelllow product No observable result 2. Suppose a protein sample with a fragment containing the following amino acid sequence is subjected to various chemical assay/tests. - Ala-Tyr-Trp-Phe-Cys-Gly - What is observed when the protein sample is subjected to lead sulfide test? Violet interface Red precipitate/solution Brown/black precipitate Yelllow product No observable result
- 1) most STR fragments used in human forensic analysis are comprised of_____ repeatsWhat can we most-accurately say about the polypeptide with the primary sequence KNEADING? a.It has two acidic R groups b.It has three basic R groups c. It has two nonpolar neutral R groups d. It contains three polar neutral R groups e. It contains a disulfide linkage1. Draw the structure of the polyribonucleotide UAGCCUG. 2. Draw the structure of the polydeoxyribonucleotide CGTAGAT.