1. Based on the results obtained give the differences between the hydrolyzed and unhydrolyzed RNA.
Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…
A: 5' cap help in translation and prevent degradation of m- RNA and poly A tail help on initiation of…
Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he…
A: DNA replication is the process by which a new DNA molecule is formed and this process is known as…
Q: 2. Explain the method used for stabilizing the crosslinks between two polypeptide chanis
A: Polypeptides are made up of chains of amino acids joined together by peptide bonds. The free amino…
Q: 3. List the sequences for the "stop" codons.
A: A codon is a three-nucleotide long stretch present in the messenger RNA (ribonucleic acid). It codes…
Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…
A: transcription is the process by which messenger rna is made from dna .
Q: 13. What is the complimentary sequence of the following strand? CCCCTTAGGAACC? a. CCCCTTAGGAACC b.…
A: Nucleic acids are biopolymers formed of repeating units of monomers called nucleotides. There are…
Q: 1. What is the concept of universality of the genetic code? What are the exceptions to this…
A: Introduction The sequence of nucleotides on m-RNA that code for an amino acid is known as genetic…
Q: 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA…
A:
Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF
A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…
Q: List the amino acid sequence of the protein coded for.…
A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…
Q: 7. Predict the bases that will pair with the following bases to form the complementary messenger…
A: There are basically 4 types of nitrogenous bases ATGC and in RNA thymine is replaced with Uracil.
Q: 1. Based on the results obtained give the differences between the hydrolyzed and unhvdrolvzed RNA,
A: RNA (ribonucleic acid) is a single chain polymer of nucleotides that is linked by phosphodiester…
Q: 1. Explain why the primary structure sequence -Lys-Leu-Trp-Asp- may promote a-helix formation while…
A: The formation of α helix is occurred due to attachment of H of N of Cα of first (n) amino acid to…
Q: 6. Two possible paint mutations are the substitution of lysine for leucine or the substitution of…
A: Every physiological characteristic or metabolism of our body mainly controlled by proteins. These…
Q: 1. From standpoint of replication and transcription, explain how RNA polymerase is allowed to…
A: Replication is the process of formation of two identical DNA copies from one parent DNA.For this…
Q: What codons are found in the mRNA for the two mutated DNA
A: 1. The cell reads the sequence of the gene in groups of three bases. There are 64 different codons:…
Q: 2. Provide the sequences of the template and coding strands of a DNA double helix that was used to…
A: The RNA or ribonucleic acid is produced from the DNA by the transcription process. RNA is used for…
Q: 2. A biochemical analysis of an RNA sample showed 40 % ofnitrogenous bases were cytosine (C). What…
A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and…
Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?
A: DNA is the store house of genetic information. This genetic information expressed by the formation…
Q: 17. Which of the following is the CORRECT base pairings in RNA? * A. Uracil and Adenine B. Thymine…
A: Introduction :- A base pair is a basic unit of double-stranded nucleic acids, consisting of two…
Q: 1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: The genetic code is a set of three-letter combinations of nucleotides that corresponds to a specific…
Q: 21. Which of the following mutations would be expected to have the most harmful effect on the…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What is the chemic name and formula of the precipitate for the test for phosphate? 2.suppose biuret…
A: Dear students, As the given question has multiple questions and here it is not specified which…
Q: 7. The following amino acid sequence represents part of a protein. The normal sequence and a mutant…
A: A mutation is a change in the nucleotide sequence of an organism's genome, virus, or…
Q: 1. True or False a) DNA bases, when coiled to histones, become inaccessible to RNA polymerase. b)…
A: Transcription is the process by which the information of DNA are copied into mRNA and this process…
Q: 2. Describe the process that is occurring in this image protein nibosome
A: The proteins are the final product of a gene that perform all the functions within the cell.…
Q: 8. Which RNA molecule is NOT involved in the processes of transcription and translation? A.…
A: RNA or Ribonucleic acid is a type of nucleic acid. Transcription is the process of synthesis of…
Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…
A: Codons are the mRNA triplet nucleotides and are the coding sequences. They are translated to form a…
Q: What codons ar e found in the mRNA for the two mutated DNA?
A: Answer 1: - There are 14 codons in the original DNA sequence. Answer 2:- Similarly, there are 14…
Q: 30. How can one identify the presence of introns in a hybrid of DNA and mRNA? Give an example of…
A: Introns are non-coding sequences, whereas exons are coding sequences. Splicing is the process of…
Q: 3. Give the different hydrolytic products of : a. DNA b. RNA
A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…
Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…
A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…
Q: 2. Decode the hidden message from the polypeptide coded by the DNA sequence below. Express the amino…
A: The given sequence can be read by combining sets of three nucleotides per amino acids.
Q: What are the components of the initiation complex for translation
A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…
Q: 1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA…
A: Since you have asked multiple questions, we will answer first question for you. In order to get…
Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…
Q: 11. Consider the sequence shown, determine the complementary RNA and the amino acids DNA TAC GTA TTT…
A: In this question, we are given sequence of DNA from which we have to determine RNA and protein…
Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…
A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…
Q: Compare the structure and functions of DNA nad RNA.
A: Nucleic acids DNA RNA DNA : Deoxyribonucleic acid : It is long chain polymer of two…
Q: 6. If you are given the DNA sequence: T-A-C-C-G-A-A-T determine the complementary RNA strand.
A: Introduction :- The term "DNA sequencing" refers to a common laboratory procedure for determining…
Q: 6. What are the similarities and differences between the transcription process and the replication…
A: Replication A biological process of in which two identical copies of DNA are produced.
Q: 4. Discuss and detail reasons why eukaryotic organisms appear to have more DNA than is necessary to…
A: The coding sequences of Eukaryotic DNA is called exon and the non coding sequence of Eukaryotic DNA…
Q: 3. The data in the following table represent the base composition of two double stranded DNA sources…
A: Ervin Chargaff discovered the Base proportion in double stranded DNA. The findings in his study came…
Q: 1. A DNA base sequence transcribed into messenger RNA in the following sequence:…
A: Introduction :- Transcription is the process through which synthesis of mRNA molecules takes place ,…
Q: 1. Give the different hydrolytic products of : a DNA b. RNA 2. Enumerate the biological functions of…
A: The biological macromolecules that constitute a living system are : Nucleic acid (DNA and RNA),…
Q: Suppose Biuret test is conducted to a solution of RNA. Will it give a positive result or not?…
A: The presence of biomolecules can be detected by various chemical compounds.
Q: Regarding the triple DNA code, which of the following statements is true?
A: The genetic code refers to the set of rules that all living organisms use to encode information,…
Q: 3. Why do Class I DNA based transposable elements have terminal inverted repeats?
A: Transposable elements also known as transposons as well as jumping gene. As the name suggests it is…
HYDROLYSIS OF
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. Explain the central dogma - how DNA, RNA, and proteins are related.7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA product when the DNA is transcribed.c. What is the resulting amino acid sequence which will result from the mRNA?
- 1. a)how is it possible for such drugs to selectively kill bacterial cells and not our own cells? b)Provide an example of post-translational regulation of protein activity and explain the advantage of regulating each protein/process at the post-translational level instead of the transcriptional level.6. Please describe the events that may result in a mature protein not having methionine asthe N-terminal amino acid.1) List 5 factors involved in the process of either initation or elongation of translation.
- 3. List the amino acid sequence of the protein coded for. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU asap1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…