2. A. Proteins stick to DNA through hydrogen bonds. Draw your choice of a correctly hydrogen bonded Watson and Crick base pair. B. Draw your choice of any amino acid side chain correctly hydrogen bonded to the available edge of the base pair.

2. A. Proteins stick to DNA through hydrogen bonds. Draw your choice of a correctly hydrogen bonded Watson and Crick base pair. B. Draw your choice of any amino acid side chain correctly hydrogen bonded to the available edge of the base pair.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 4TYU: The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds...

See similar textbooks

Related questions

Q: A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C]…

A: According to Chargaff's rule the percentage of Adenine [A] is equal to Thymine [T]. So if the given…

Q: 1. Imagine that you are analyzing a DNA sample from the liver tissue of a newly discovered species…

A: Since you have asked multiple question, and need help in 1 & 2, we will solve the first and…

Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10° D. In your answers,…

A: The molecular mass of Escherichia coli DNA genome is 3.1 × 109 Daltons. The average molecular weight…

Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10 9 D. In your…

A: Hi! As you have posted multiple questions, I will be answering the first and third question for you.…

Q: Q.)The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…

A: (A) No. Of base pairs in the bacterium continue Some important Data-- Molecular weight of one base…

Q: The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds…

A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Q: 2. Name the first complementary base from the 3' direction. Type your

A: RNA chain is synthesized from the 5' end to the 3'-hydroxyl group of the last ribonucleotide in the…

Q: 2. a. Research DNA quantitation by UV absorption. Explain what A230, A260 and A280 values represent.…

A: Every biomolecule have an unique absorbance curve of their own. This simply means that, the…

Q: A key difference between B DNA and Z DNA is thata. B DNA is right-handed, whereas Z DNA is…

A: DNA is the molecule which carries the genetic information of the cell. It is a long biopolymer of…

Q: 3. The Watson-Crick model pictures DNA as as the step. spiral staircase with the as the handrails…

A: DNA has a double-stranded structure in which two strands run in an anti-parallel direction. DNA…

Q: 1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA…

A: Deoxyribonucleic acid DNA isolation is referred to the extraction process of DNA from different…

Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10° D. In your answers,…

A: Given data: The molecular mass of the genome of Escherichia coli = 3.1 x 109 Da. The average…

Q: σ factors bind to what types of sequences on DNA? a. Shine-Delgarno sequences. b. TATA box…

A: Sigma (σ) factor of RNA polymerase holozyme is a DNA binding promoter that determines transcription…

Q: What would fit best for right properties of dna?

A: Introduction: DNA may be a chemical basis of heredity and will be thought to be the depository…

Q: Biochemist Erwin Chargaff was the first to discover that, in DNA, [A] = [T] and [G] = [C]. These…

A: In a double-stranded stranded DNA, the amount of purine nucleotide is equivalent to the number of…

Q: Given the choices, a. 25 b. 18 c. 23 d. 21 how many hydrogen bonds are present in a DNA double…

A: DNA is also known as deoxyribonucleic acid. DNA acts as genetic material in most of the organisms…

Q: 1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle…

A: 1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle…

Q: The Watson and Crick model of DNA structure shows the following EXCEPT A the turn of the DNA helix…

A: Watson and Crick proposed a specific DNA structure called the 3-dimensional DNA. DNA is comprised of…

Q: 5. If 30% of the bases in human DNA are A, (a) whatpercentage are C? (b) What percentage are T?(c)…

A: There are four nitrogenous bases present in a molecule of DNA. They are adenine, guanine, cytosine…

Q: Discuss the differences between the Z-Form, A-form and B-form Dna

A: DNA (Deoxyribonucleic acid) is a molecule which is present in the nucleus of the cell. It contains…

Q: At that time, why did it seem reasonable for the bases to be on the outside of the DNA molecule and…

A: James Watson and Francis Crick formulated a possible structure of DNA and then determined whether…

Q: Suppose I label the newly synthesized DNA with P, grind up the treated cells and run their single…

A: * DNA was labelled with P32 was grinded and treated cells run through a gel which contains a single…

Q: You analyse some DNA using an automated sequence reaction. The first peak you observe is labeled…

A: Given: You analyse some DNA using an automated seqyence reaction. The first peak you observe is…

Q: 2.) It was Rosalind Franklin that helped Watson and Crick realize that the sugar-phosphate backbone…

A: Building blocks of DNA that had been known for many years yet the DNA structure was not known the…

Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…

A: The bacterium Escherichia coli, commonly known as E. coli belongs to the family of gram negative…

Q: The alternating sugar-phosphate backbone of the DNA is hydrophobic Select one: True False

A: DNA or Deoxy-ribonucleic acid is a complex molecule which contains the genetic code of a living…

Q: The Watson and Crick model of DNA structure shows A pair bonding between bases a purine and a purine…

A: * The double helical structure of Dna was proposed by Watson and crick * They proposed that The…

Q: Mention and explain 4 characteristics of the Structure of DNA.

A: DNA- Deoxyribose Nucleic Acid

Q: The Watson-Crick double helix immediately suggested that DNA is replicated in a manner. a. semi…

A: The genetic material is transmitted to the next generation through DNA. A cell leads to several more…

Q: 3) Erwin Chargaff is considered one of the pioneering scientists in the field of molecular biology.…

A: According to the Chargaff’s Rule, DNA consists of nucleotides and contains nitrogen bases (Adenine,…

Q: A. In the product, the underlined regions are called what? B. What functional groups are present in…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: (a) What is meant by the term base pairing?(b) Which bases pair with which other bases?(c) How many…

A: A nitrogenous base is a molecule that contains nitrogen and has the chemical properties of a base.…

Q: b. What is the difference between the 3' and the 5' ends of a nucleotide chain? C. Do the chains run…

A: The double stranded helical structure of DNA (deoxyribonucleic acid) was first demonstrated by James…

Q: 6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ?…

A: Nucleosides contain only sugar and a base whereas Nucleotides contain sugar, base, and a phosphate…

Q: 1. The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 D. In your…

A: DNA (deoxyribonucleic acid) is a double helix structure that is made up of two intertwined…

Q: Which statement about nonpolar interactions in the formation of the DNA double helix is INCORRECT?…

A: Deoxyribose Nucleic Acid (DNA) is a nucleic acid that acts as the genetic material in all organisms…

Q: 1) The Qiagen DNeasy DNA extraction kit is used to extract DNA from a liver cell line for subsequent…

A: DNA extraction aids in the study of the genetic origins of different illnesses. For the development…

Q: When DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken…

A: Introduction: DNA is the type of nucleic acid that is present in the nucleus of the cell. It is the…

Q: In the Watson-Crick structure of DNA, the: a. adenine content of one strand must equal the thymine…

A: Watson and Crick model of DNA has two strands that wound around each other and form double hellicle…

Q: Once you had your DNA sample extracted from your cells, why did we add the yellow Master Mix…

A: The DNA sample extracted from the cells is amplified using a method called the Polymerase Chain…

Q: AKS 5a: Which of the following combinations is true of the nucleotide composition of a sample of…

A: DNA is a double helix with complementary nitrogenous bases making hydrogen bonds across the two…

Q: Which of the following statements DOES NOT apply to the Watson and Crick model of DNA? a. The two…

A: In 1953, J.D Watson and F.H.C Crick proposed the three dimensional model of DNA. According to this…

Q: 3. The Watson-Crick model pictures DNA as a as the step. spiral staircase with the as the handrails…

A: The double helical structure of DNA was first proposed by James Watson and Francis Crick. According…

Q: 1.What are nucleic acids? What are their functions? 2.Illustrate and compare the primary and…

A: Nucleic acids are one of the biomolecules that are important for the carrying of genetic information…

Q: 3. If one measures a 20 ul sample of DNA with an absorbance reading at A280 mm of 0.35 and an…

A: Introduction :- DNA ( Deoxy ribonucleic acid ) is made up nucleotide units , which are made up of a…

Q: 1) The nitrogenous bases content of a sample of DNA was found to be 3.2% adenine. Determine the…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Question

I need help with this question

2.
A. Proteins stick to DNA through hydrogen bonds. Draw your choice of a correctly hydrogen
bonded Watson and Crick base pair.
B. Draw your choice of any amino acid side chain correctly hydrogen bonded to the available
edge of the base pair.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Answer to (A)

VIEW

Answer to (B)

VIEW

Step by step

Solved in 3 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ? b.) Based on the complementary base pairing rules we know that: A(denosine) pairs with _________ , and that G(uanine) pairs with _________.
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA sample is below 1.8 A260/A280 so, where did the proteincontamination come from? Note: Cite the in-text citation and references
Which of the following does not contribute to the stability of the DNA? A. The presence of hydrogen between nitrogenous bases. B. Presence of the N-glycosidic bond between the nitrogenous base and phosphate group C. Presence of phosphodiester bond between the sugar and phosphate group on the sugar-phosphate backbone. D. Hydrophobic interaction between stacked nitrogenous bases.
The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds between deoxyribose molecules (b) ionic bonds between phosphate groups (c) covalent bonds between nucleotide bases (d) covalent bonds between deoxyribose molecules (e) hydrogen bonds between nucleotide bases
State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helix
Briefly explain (1) the structure characteristics of DNA, (2) why different DNA molecules (i.e., with different sequences) could adopt the same B-form double helical structure, and (3) how certain proteins could recognize the specific sequences with the common B-form DNA.
"Chargaff's rules" about the composition of bases in DNA dictates that A. the sum of purine residues must equal the sum of pyrimidine residues. B. the sum of A-T base pairs must equal the sum of G-C base pairs. C. the base composition of DNA is the same in all species. D. DNA specimens isolated from different tissues of the same species vary in base composition.
The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10 9 D. In your answers, show how you came up to each result?(a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in micrometer?
Q.)The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers, show how you came up to each result? (a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in mm?
In the Watson-Crick structure of DNA, the: a. adenine content of one strand must equal the thymine content of the same strand. b. nucleotides are arranged in the A-form. c. purine content (fraction of bases that are purines) must be the same in both strands. d. two strands are parallel. e. the strands are complementary to each other.